Ктр 57 мм: Здравоохранение и медицинская наука Республики Беларусь на Med.BY

Содержание

Ктр при беременности, по неделям беременности — www.wday.ru

На размере КТР никак не сказываются пол плода, его расовая принадлежность и другие индивидуальные особенности. Он зависит только от срока беременности, поэтому измерение КТР – это прекрасный способ установить точный срок для женщин с нерегулярным циклом.

В среднем КТР имеет следующие показатели, в мм:

  • 6−7 недель – от 5 до 11;
  • 8 недель – от 12 до 22;
  • 9 недель – от 16 до 27;
  • 10 недель – от 24 до 38;
  • 11 недель – от 37 до 54;
  • 12 недель – от 42 до 59;
  • 13 недель – от 51 от 75;
  • 14 недель – от 63 до 89.

Установить срок с точностью до дня может только врач при ультразвуковом исследовании. Чтобы наиболее точно определить КТР, специалист измеряет его в тот момент, когда эмбрион максимально распрямляется.

Чем больше срок беременности, тем интенсивнее растет ребенок. Даже если на первых неделях он немного отставал в росте, к концу первого триместра эмбрион растет более стремительно, увеличиваясь в размерах с каждым днем.

Если КТР превышает средние показатели, можно предположить, что родится крупный ребенок весом более 4 кг.

Если же показатели, напротив, не дотягивают даже до нижней границы нормы, это может говорить о следующем:

  • У женщины была поздняя овуляция, в таком случае истинный срок будет меньше на 7−10 дней. Для проверки этого предположения нужно повторить УЗИ через неделю, чтобы увидеть динамику роста эмбриона.
  • Беременность не развивается, плод погиб. Врач зарегистрирует на УЗИ отсутствие движений и сердцебиения.
  • У ребенка есть генетические нарушения. Чтобы подтвердить это, потребуются дополнительные исследования.

Отклонение от нормы требует пристального внимания врача.

Копчико-теменной размер – один из тех параметров, которые в первую очередь интересуют врача на первом скрининге, наряду с толщиной воротникового пространства и длиной носовой кости. На основании полученных данных делаются выводы о благополучном развитии беременности.

ТехноВита — Упругая муфта KTR ROTEX Стандарт

Из-за обширного применения ROTEX® в различных отраслях и разнообразных монтажных условиях для этой муфты существуют разные типы ступиц. Они отличаются в основном тем, что могут обеспечить соединение вал-ступица, как шпоночно-шлицевым, так и фрикционным способом, однако также представлены решения для таких монтажных ситуаций, как валы со встроенными приводными кулачками и подобных.

Литые и порошковые металлы

ROTEX® Порошковая сталь (Sint)
Типор-р Компонент Зубчатый венец¹ Ном. крут. момент [Nm] Размеры [mm]
Чистовое отверстие d Общие Резьба для уст. винта
92 Sh-A 98 Sh-A L l1;l2 E b s DH dH
D
N G t TA [Nm]
14 1a 7,5 12,5 без отв.,8,10,11,12,14,15,16 35 11 13 10 1,5 30 10 30 M4 5 1,5 1,5
19 1a 10 17 без отв.,14,16,19,20,22,24 66 25 16 12 2,0 40 18 40 М5 10 2 2
24 35 60 без отв.,Ø24 78 30 18 14 2,0 56 27 40 М5 10 2 2
ROTEX® Литой алюминий (AL-D)
Типор-р Компонент Зубчатый венец¹ Ном. крут. момент [Nm] Размеры [mm]
Чистовое отверстие d Общие Резьба для уст. винта
92 Sh-A 98 Sh-A 64 Sh-D L l1;l2 E b s DH DZ dH D;D1 N G t TA[Nm]
19 1 10 17 6-19 66 25 16 12 2 41 18 32 20 M5 10
2
1a 19-24 41
24 1 35 60 9-24 78 30 18 14 2 56 27 40 24 M5 10 2
1a 22-28 56
28 1 95 160 10-28 90 35 20 15 2,5 66 30 48 28 M8
15
10
ROTEX® Чугун (GJL)
•38 1 190 325 405 12-40 114 45 24 18 3 80 38 66 37 M8 15 10
1a 38-48 78
1b 12-48 164 70 62
•42 1 265 450 560 14-45 126 50 26 20
3
95 46 75 40 M8 20 10
1a 42-55 94
1b 14-55 176 75 65
•48 1 310 525 655 15-52 140 56 28 21 3,5 105 51 85 45 M8 20 10
1a 48-62 104
1b 15-62 188 80 69
•55 1 410 685 825 20-60 160 65 30 22 4 120 60 98 52 M10 20 17
1a 55-74 118
•65 1 625 940 1175 22-70 185 75 35 26 4,5 135 68 115 61 M10 20 17
•75 1 1280 1920 2400 30-80 210 85 40 30 5 160 80 135
69
M10 25 17
•90 1 2400 3600 4500 40-97 245 100 45 34 5,5 200 218 100 160 81 M12 50 140
ROTEX® Чугун с шаровидным графитом (GJS)
•100 1 3300 4950 6185 50-115 270 110 50 38 6 225 246 113 180 89 M12 30 40
•110 1 4800 7200 9000 60-125 295 120 55 42 6,5 255 276 127 200 98
M16
35 80
•125 1 6650 10000 12500 60-145 340 140 60 46 7 290 315 147 230 112 M16 40 80
•140 1 8550 12800 16000 60-160 375 155 65 50 7,5 320 345 165 255 124 M20 45 140
•160 1 12800 19200 24000 80-185 425 175 75 57 9 370 400 190 290 140 M20 50 140
•180 1 18650 28000 35000 85-200 475 195
85
64 10,5 420 450 220 325 156 M20 50 140

•=Если материал не обозначен в заявке особо, его выбор обуславливается расчётами/другой информацией в заявке.

¹Максимальный крутящий момент муфты ТкМакс=номинальный крут. Тк.ном×2. Информацию о подборе см. на стр.10 и сл.

Пример заявки:

ROTEX® 38 GJL 92 Sh-A 1a Ø45 1 Ø25
Типор-р муфты Материал Твёрдость зубчатого венца Компонент Чист. отверстие Компонент Чист. отверстие

Компоненты

AL-D (резьбовое отверстие напротив шпоночного паза)

GJL/GJS (Резьбовое отверстие в шпоночный паз)

/UL/-и морское исполнение, сталь

ROTEX® Сталь (St)
Типор-р Компонент Зубчатый венец¹ ном. крут. момент [Nm] Размеры [mm]
Чистовое отверстие d Общие Резьбовое отверстие для уст. винта
92 Sh-A 98 Sh-A 64 Sh-D L l1;l2 E b s DH dH D N G t TA [Nm]
14 1a 7,5 12,5 16 0-16 35 11 13 10 1,5 30 10 30 M4 5 1,5
1b 50 18,5
•19 1a 10 17 21 0-25 66 25 16 12 2 40 18 40 M5 10 2
1b 90 37
•24 1a 35 60 75 0-35 78 30 18 14 2 55 27 55 M5 10 2
1b 118 50
•28 1a 95 160 200 0-40 90 35 20 15 2,5 65 30 65 M8 15 10
1b 140 60
38 1 190 325 405 0-48 114 45 24 18 3 80 38 70 27 M8 15 10
1b 164 70 80
42 1 265 450 560 0-55 126 50 26 20 3 95 46 85 28 M8 20 10
1b 176 75 95
48 1 310 525 655 0-62 140 56 28 21 3,5 105 51 95 32 M8 20 10
1b 188 80 105
55 1 410 685 825 0-74 160 65 30 22 4 120 60 110 37 M10 20 17
1b 210 90 120
65 1 625 940 1175 0-80 185 75 35 26 4,5 135 68 115 47 M10 20 17
1b 235 100 135
75 1 1280 1920 2400 0-95 210 85 40 30 5 160 80 135 53 M10 25 17
1b 260 110 160
90 1 2400 3600 4500 0-110 245 100 45 34 5,5 200 100 160 62 M12 30 40
1b 295 125 200
100 1 3300 4950 6185 0-115 270 110 50 38 6 225 113 150 89 M12 30 40
110 1 4800 7200 9000 0-125 295 120 55 42 6,5 255 127 200 96 M16 35 80
125 1 6650 10000 12500 60-145 340 140 60 46 7 290 147 230 112 M16 40 80
140 1 8550 12800 16000 60-160 375 155 65 50 7,5 320 165 255 124 M20 45 140
160 1 12800 19200 24000 80-185 425 175 75 57 9 370 190 290 140 M20 50 140
180 1 18650 28000 35000 85-200 475 195 85 64 10,5 420 220 325 156 M20 50 140

•=Если материал не обозначен в заявке особо, его выбор обуславливается расчётами/другой информацией в заявке.

¹Максимальный крутящий момент муфты ТкМакс=номинальный крут. Тк.ном×2. Информацию о подборе см. на стр.10 и сл.

Пример заявки:

ROTEX® 38 St 92 Sh-A 1-Ø45 1-Ø25
Типор-р муфты Материал Твёрдость зубчатого венца Компонент Чист. отверстие Компонент Чист. отверстие

7 самых главных показателей на УЗИ во время беременности — Рамблер/новости

Узнайте, на какие показатели УЗИ во время беременности будущей маме стоит обратить внимание и что они говорят о здоровье плода.

Во время беременности женщине несколько раз назначают ультразвуковое исследование. Как правило, его делают раз в триместр, то есть минимум 3 раза в течение всего срока вынашивания ребенка, но в некоторых случаях к этому методу прибегают чаще.

«Летидор» выделил 7 главных показателей УЗИ, по которым врач судит о развитии будущего малыша.

Есть такое понятие фетометрия, оно означает измерение размеров плода при помощи УЗИ. На протяжении многих десятилетий специалисты в области акушерства изучали различные данные, полученные этим методом. На основе статистического анализа им удалось получить результаты и составить таблицы, по которым теперь оценивают состояние здоровья плода на различных сроках беременности. Эти данные говорят не только о сроке гестации (срок беременности), но и о правильном развитии малыша на конкретной неделе.

Воротниковая зона плода (ТВП) и носовая косточка

Этот показатель имеет первостепенное значение во время первого скрининга (примерно с 11-й по 14-ю неделю).

Аббревиатура ТВП означает толщину воротниковой зоны (участок кожной складки на задней поверхности шеи).

Увеличенный размер этого пространства (2,7-3 мм) позволяет врачу, судить о том, что плод, возможно, поражен трисометрией 21, то есть синдромом Дауна.

Примерно в это же время исследуется еще один параметр – носовая косточка.

В 11 недель она должна визуализироваться.

А на 14-15 неделе можно определить размеры от 2,9 до 4,7 мм.

Копчико-теменной размер (КТР)

Это длина эмбриона в первом триместре беременности от макушки до копчика.

КТР позволяет уточнить в частности срок гестации и возраст плода.

С 11 по 14 неделю нормой считается 45-80 мм.

Бипариентальный размер головы (БПР) и лобно-затылочный размер (ЛЗР)

БПР — это размер между наружным и внутренним контуром костей темени (фактически от одного виска до другого). Его определяют в зависимости от срока беременности.

В 12 недель примерная норма – 21 мм, на 16-й – 34 мм, на 32-й – 82 мм, на 40-й – 96 мм.

Но вместе с бипариентальным размером головы важно учитывать и лобно-затылочный размер (ЛЗР) плода, то есть расстояние от лобной до затылочной кости.

При первом скрининге он обычно не превышает 31 мм, затем соответственно увеличивается параллельно с БПР.

В конце беременности скорость роста этих показателей меняется – замедляется.

Кроме того, по БПР врач может судить о сроке беременности, но только до 22-23 недели, а уже после 28-29 недели достоверность снижается, а ближе к родам форма головы может поменяться, и тогда меняются и нормы БПР.

В целом по показателям БПР и ЛЗР судят о строении мозга, костей черепа, наличии новообразований (кист, например).

Это еще один важный показатель фетометрии, который позволяет определить срок беременности (возраст плода), а также судить о видимых нарушениях развития у ребенка.

На сроке 12-13 недель длина бедра составляет 9-12 мм, на 22-й неделе – 40 мм, на 32-й – 63 мм, а на 40-й – 77 мм.

Размер (условно рост) и вес плода измеряют с момента первого планового УЗИ. Эти показатели очень примерны, ведь малыш с весом 2300 г может родиться совершенно здоровым, особенно если это была многоплодная беременность. Равно как и вес новорожденного 4500 г и выше часто не являются поводом для беспокойства.

Чтобы иметь представление о том, как развивается плод, вот примерные показатели:

на 11-й неделе вес составляет 11-16 г, а рост – 6-9 см;

на 22-й неделе вес – до 500 г, а рост – до 30 см,

на 32-й неделе вес до 1950 г, рост – до 44, 5 см,

на 40-й неделе – вес – 3500 г, рост – 54 см.

Внимание! Все приведенные выше цифры не являются однозначной нормой – их всегда сравнивают и с другими параметрами, в том числе с анализами крови.

Мы приводим лишь те показатели, на которые нужно обращать внимание будущей маме, когда она проходит УЗИ и у нее есть возможность попросить акушера-гинеколога прокомментировать результаты.

Давайте дружить в социальных сетях! Подписывайтесь на нас в Facebook , «ВКонтакте» и «Одноклассниках» !

Копчико теменной размер плода по неделям беременности. Что за показатель? На что могут указывать отклонения показателей КТР

Копчико-теменной размер (КТР) – наибольшее расстояние от копчика до центральной точки головы (темечка) плода. Этот показатель позволяет очень точно, с погрешностью от 1 до 4 дней, определить срок беременности и дату родов. При нерегулярном цикле этот метод будет более корректным, чем определение сроков беременности по овуляции, а при регулярных месячных обычно просто сравнивают полученные значения с акушерским сроком.

Чем меньше срок беременности, тем информативнее этот показатель. У эмбриона еще практически нет конечностей, а есть только сердце и тельце. Поэтому размер плода позволяет оценить его состояние и проследить за развитием спустя какое-то время.

Благодаря измерению и отслеживанию размеров на продолжении нескольких недель (исследование в динамике) можно выявить аномалии в развитии малыша на ранних сроках. Врачи отслеживают КТР с 7 до 11 (реже 14) недели беременности, после чего уже пользуются другими значениями для наблюдения за малышом – фетометрией плода. Идеальное время для определения КТР — 11 недель. В это время обычно и назначают .

Как измеряют размеры плода?

Для определения копчико-теменног о размера используют ультразвуковое исследование. Врач сканирует плод, условно деля тело на две симметричные половины, и измеряет длину плода от темечка до копчика несколько раз. После этого выбирает максимальный из полученных размеров. Если малыш двигается при сканировании, КТР измеряют в момент его наибольшего разгибания.

Подготовиться к исследованию просто – нужно делать его на голодный желудок и за час до УЗИ выпить 1 л воды.

Полученные значения сравнивают с табличными значениями КТР плода по неделям беременности.

С течением беременности размеры плода постоянно увеличиваются, что позволяет заключить в некоторой мере, что беременность проходит нормально и малыш тоже в порядке. В таблице указаны нормальные значения КТР: минимальное (столбец 5-процентиль), среднее (столбец 50-процентиль) и максимальное (95-процентиль).

При необходимости более точного измерения, отслеживании размеров плода в динамике используют таблицы по неделям и дням беременности.

Необходимо отметить, что все расшифровки результатов нужно проводить с доктором. Это убережет вас от неправильных выводов и от лишних переживаний. Незначительные отклонения от нормы могут и не означать наличие аномалий у ребенка. Так как плод прибавляет в росте ежедневно, таблицы разработаны на каждый день беременности с 7 по 14 неделю. Но при этом допускается отклонение в размерах малыша, соответствующее 4 дням. Во втором триместре измеренный КТР зачастую не соответствует среднестатистиче скому значению. С 16 недели копчико-теменной размер плода не учитывают при обследованиях.

Развитие плода на 11-12 неделях беременности

Первое плановое обследование УЗИ назначается обычно на 11-13 неделе. Первый триместр уже позади и начинается новый этап развития малютки. В это время у плода начинает активно работать гормональная система и совершенствуется работа мозга. Внутренние органы тоже готовятся вовсю – кишечник начинает сокращаться, а почки наполняются мочой. Структура скелета изменяется – хрящ заменяет костная ткань. На 12 неделе у эмбриона исчезают перепонки на пальчиках, а уже спустя неделю он впервые пробует шевелиться и сгибать кисти. В конце двенадцатой недели беременности размер плода в среднем составляет 5,3 мм. Дальше темпы роста малыша будут увеличиваться – уже через пару недель он будет вырастать на 2 мм вместо 1 мм ежедневно.

Набирает популярность мнение некоторых гинекологов о целесообразности проведения первого исследования УЗИ на 11 неделе. Именно в этот период лучше всего поддаются диагностике некоторые тяжелые пороки развития эмбриона. Также в 11 недель точнее всего можно определить срок зачатия и, соответственно, рассчитать предполагаемую дату родов. Обычно гинеколог ведет оба срока – акушерский, рассчитанный от последней менструации и срок, который был установлен по КТР.

КТР больше или меньше нормы

Увеличение размера плода свидетельствует о динамичном развитии малютки в утробе матери. Но бывает, что КТР плода увеличивается стремительно и повышен на 1 неделю или больше. Это не повод для паники – возможно, у вас просто будет крупный малыш. При этом, конечно же, стоит обратить на это внимание и обсудить результаты исследования с лечащим врачом. Вам не нужно лечиться препаратами, которые стимулируют ускоренный обмен веществ. К ним относятся поливитамины и, например, актовегин. Возможно, врач также пересмотрит ваш рацион и попросит отказаться от слишком калорийных и не очень полезных продуктов. Нужно также исключить , анатомические дефекты и сахарный диабет у плода. Все эти проявления могут влиять на размер малыша.

Бывает, что размеры плода уменьшаются на 11-13 неделях. При этом табличные нормы КТР плода по неделям не выполняются. Причин может быть несколько:

    Неправильно определен акушерский срок беременности . Возможно, ваша овуляция была значительно позже середины цикла. При этом КТР на 11-13 неделях будет отличаться от предполагаемого акушерского срока. В таких случаях назначают повторное исследование через 7-10 дней. По результатам двух измерений делают вывод об истинном сроке беременности.

    Недостаток гормонов . Чаще всего это недостаток прогестерона, который играет очень важную роль на протяжении всех 40 недель беременности, а особенно в . Опасность подобного рода недостаточности – в возможном прерывании беременности. Врач обычно назначает соответствующие лекарственные препараты, которые содержат прогестерон (, и т.д.)

    , гибель плода . Если не наблюдается двигательная активность и сердечная деятельность – это сигнал к срочному посещению вашего гинеколога. Своевременная консультация и медицинское вмешательство может спасти жизнь или репродуктивную функцию беременной женщине.

    Инфекционные заболевания . Также оказывают влияние на развитие и размеры малыша. Выявляются с помощью специальных анализов, после чего проводится направленная терапия.

    Заболевания внутренних органов мамы . К ним относятся болезни сердца и щитовидной железы.

    Нарушения слизистой матки . В этом случае плод не в состоянии прикрепиться к стенке матки и нормально развиваться. Часто за этим следует самопроизвольное прерывание беременности.

    Генетические нарушения плода . Для определения подобного рода заболеваний в первом триместре наряду с УЗИ проходят биохимический Итак, КТР плода – косвенный, но очень важный показатель развития малютки в первом триместре. Своевременное прохождение плановых исследований и консультации врача-гинеколога помогут наполнить беременность приятными ожиданиями и хлопотами и свести к минимуму волнения.

Содержимое

Ультразвуковое исследование имеет важное значение на протяжении всего периода вынашивания ребёнка. После первого сканирования будущим родителям становится доступно много новой непонятной информации. КТР является одним из параметров УЗИ, который точно определяет срок беременности. Также с помощью этого значения можно выявить возможные отклонения в развитии плода.

Определение понятия


Копчико-теменной размер (КТР) — один из главных показателей, позволяющих отслеживать правильность развития эмбриона до 14 недели беременности. КТР определяется во время ультразвукового исследования. Понятие обозначает расстояние от наивысшей точки темечка до нижней границы копчика плода.

Врач с помощью этой величины оценивает вес малыша, срок беременности, соотносит полученную информацию с нормами, указанными в таблице. После 14 недели вынашивания ребёнка определить КТР проблематично, поскольку плод становится крупнее, и ультразвуковой датчик не может охватить этот отрезок. Поэтому о росте и развитии начинают судить по размерам отдельных частей тела крохи.

Копчико-теменной размер можно измерить по прошествии месяца с момента зачатия.

КТР измеряется на первых неделях гестации, в этот период — это единственный коэффициент, оценивающий течение беременности. Темпы роста показателя и соответствие нормам в таблице сообщают врачу о развитии плода. Также важна информация о сердцебиении крохи, которое можно зафиксировать на УЗИ начиная с 5-6 недели беременности.

Способы измерения


КТР определяется на первом УЗИ, проводимом на 12 неделе беременности. В ультразвуковом сканировании выделяются основные плоскости: сагиттальная, осевая, венечная. Копчико-теменной размер измеряется посредством сагиттального сканирования в положении полного разгибания головы эмбриона.

Врачу необходимо дождаться момента, когда плод полностью разогнётся. В эту секунду специалист делает стоп-кадр. Затем по отрезку, проложенному от темечка до копчика, оценивается исходное значение. Величину соотносят с нормами, указанными в таблицах. Полученный размер определяет точный срок беременности, ведь многие женщины имеют нерегулярный цикл либо не помнят первого дня последних месячных.

КТР устанавливает точный срок беременности, дату родов и позволяет выявить возможные аномалии в развитии плода. Бывают случаи, когда овуляция происходит позже, чем предполагает женщина либо прикрепление яйцеклетки немного запаздывает. В таких ситуациях фактический возраст эмбриона оказывается меньше, что и выявляет КТР.

Таблица норм


В первые недели беременности все эмбрионы растут в одинаковых темпах. Генетические отличия, влияющие на параметры тела, начинают проявляться чуть позже. Копчико-теменной размер не зависит от национальности, экологической обстановки и географической широты. Именно поэтому установлены общие нормы КТР по неделям беременности в таблице.

В первые недели беременности отсутствуют даже колебания в величинах. Возможные погрешности допускаются по мере роста плода. Если ультразвуковой аппарат произведён недавно, то величины в протоколе УЗИ будут точными, с десятыми долями, если нет, то числа будут целыми.

Варианты отклонения от нормальных значений


Несоответствие КТР нормам, установленным в таблицах, фиксируется часто. Отклонение может быть как в меньшую, так и в большую сторону. Отставание от нормы может иметь физиологический и патологический характер.

Увеличение копчико-теменного размера происходит по следующим причинам:

  • сахарный диабет беременных;
  • резус-конфликт;
  • крупный плод;
  • сомнения в сроках наступления последних месячных.

Для подтверждения превышения величин женщина должна повторно пройти УЗИ через 10 дней.

Уменьшение КТР вызывают следующие факторы:

  • замершая беременность;
  • недостаточный гормональный синтез;
  • запоздалое оплодотворение;
  • болезни генетического характера;
  • инфекционные заболевания.

Даже незначительное отклонение значений от нормы в таблице требует дополнительного обследования для выяснения истинной причины проблемы.

Причины


Зачастую отклонение КТР от нормальных значений объясняется неправильным подсчётом срока беременности. Подобную ошибку исправит врач, правильно определив наступление зачатия. Но нередко диагностируются серьёзные нарушения, влияющие на дальнейшее течение беременности.

Одной из причин задержки эмбрионального роста является фетоплацентарная недостаточность.

Слишком короткий копчико-теменной размер может быть вызван неправильным образом жизни женщины. Если беременная курит и употребляет алкогольную продукцию, то эмбрион развивается в нездоровых условиях, что приводит к задержке его роста.

Неразвивающаяся беременность


Гибель эмбриона может являться причиной отставания копчико-теменного размера от норм в таблицах. Если плод остановился в развитии, а выкидыш не произошёл, то КТР будет соответствовать значениям в момент гибели.

На первых неделях, когда невозможно определить сердцебиение ребёнка, через несколько дней проводят повторное сканирование для подтверждения гибели плода. В таких случаях проводят выскабливание маточной полости либо медикаментозное прерывание беременности. Во время акушерского выскабливания производится забор эмбриональных клеток для генетической экспертизы. Это необходимо для установления причин гибели зародыша.

Поздняя овуляция и оплодотворение


Сильное отклонение КТР от нормы в таблице может указывать на неверно поставленный срок либо на замедленную овуляцию. При запоздалой имплантации плодного яйца значения будут меньше нормы.

Для подтверждения этой версии необходимо сделать повторный скрининг, который назначается через неделю после первого. Если произошла ошибка в исчислении, то КТР будет увеличиваться соответственно фактической неделе беременности. Дальнейший врачебный контроль будет производиться по новым данным.

Гормональный дисбаланс


Если эмбрион развивается, но наблюдается значительное отклонение КТР от нормы в таблице, то причиной этого несоответствия может выступать проблема с гормонами. При дефиците прогестерона в женском организме происходит замедление роста плода на первых неделях беременности.

После исследования биологического материала будущей мамы, и подтверждения диагноза будет назначена гормональная терапия. Медикаментозное лечение восстанавливает уровень гормонов, что способствует нормализации копчико-теменного размера.

Инфекционные и генетические заболевания


Наличие инфекционного агента отрицательно воздействует на формирование эмбриона. Патогены вызывают несоответствие реального КТР и норм в таблицах. Поэтому беременным необходимо обследоваться, сдав требуемые анализы. Врач назначит терапевтическую схему исходя из полученных результатов.

Обычно при наличии патологических отклонений на генетическом уровне беременность самопроизвольно прерывается на первых неделях.

Другой причиной замедления темпов роста являются хромосомные заболевания: сидром Патау, Дауна, Эдвардса. Для точного выявления патологий требуется пройти дополнительные биохимические исследования, сдать ДНК-маркеры.

Патологии матки


Болезни детородного органа влияют на несоответствие КТР нормам, установленным в таблицах. К изменению величин приводят такие патологические состояния матки:

  • миома, при которой плодное яйцо не может полноценно развиваться;
  • недостаточность эндометрия, развивающаяся вследствие выкидышей, абортов;
  • эрозия шейки матки;
  • эктропион — выворот шейки матки в область влагалища, что повышает риск выкидыша.

Аномалии развития внутренних органов женщины также изменяют показатели, поэтому таких пациенток тщательно обследуют для своевременного предотвращения всевозможных рисков.

Дополнительное обследование


При несоответствии копчико-теменного размера нормам в таблице потребуется провести повторное УЗИ. Помимо сканирования, будущим мамам предлагается:

  • амниоцентез — забор амниотической жидкости с помощью пункции;
  • кордоцентез — забор крови из пуповины;
  • биопсия ворсин хориона — способ выявления врождённых аномалий из клеток, взятых из тканей, не затрагивающих плаценту.

Поскольку описанные диагностические методы являются инвазивными, то для их проведения требуется письменное согласие будущей мамы.

Существует и неинвазивный вариант — пренатальный ДНК-тест, для которого требуется венозная кровь женщины. В биологическом материале матери выявляются эритроциты малыша, из которых выделяют ДНК крохи, и устанавливают вероятность пороков развития. Подобное исследование проводят с 8 недели беременности.

КТР плода — важный показатель, позволяющий определить точный срок беременности и выявить возможные патологии. Несоответствие показателя норме в таблице требует проведения дополнительных обследований.

Двенадцать недель беременности – знаменательная дата для женщины, поскольку это срок окончания первого триместра. В этот период плацента вырабатывает достаточно прогестерона, и с угасанием гормональной функции постепенно уменьшается желтое тело. В это время проводится скрининг первого триместра (с 11 по 13 недель и 6 дней), для выявления группы риска хромосомных аномалий, а также . Ультразвуковое исследование в 12 недель беременности, развитие плода показывает очень точно, особенно показатель срока.

Важным измерением, которое имеет одно из первостепенных значений, является КТР плода в 12 недель. Этот показатель используется для определения размера плода и подсчета сроков беременности в совокупности с приблизительным весом. Копчико-теменной размер 12 недель составляет около 5,3 см. Если проходило без осложнений, и он рос на 1 мм в день, то зародыш человека 12 недель ускоряет темп роста до 1,5-2 мм в день. Врачи рекомендуют проводить измерение КТР плода в 11 или 12 недель.

Следует учитывать, что величина копчико-теменного размера зависит от срока беременности с точностью до дня, так, нормальная погрешность составляет три-четыре дня. Нормальный средний показатель КТР эмбриона составляет 51 мм. При незначительном отклонении не стоит переживать – возможны нормальные колебания от 42 до 59 мм.

Для сравнения укажем КТР плода в 11 недель: нормальный показатель составляет 42 мм, допустимые отклонения в норме составляют 34-50 мм. При сравнении данных показателей видно – как важен каждый день для проведения УЗИ.

Будущим мамам конечно интересно – как выглядит и что умеет плод в 12 недель. Во время УЗИ мама может увидеть, как ее малыш сосет палец, и услышать 110-160 ударов в минуту биение маленького сердца. Малыш активно двигается и переворачивается в плодном пузыре, грудь опускается и поднимается во время дыхания. Также плод уже обладает умением зажмуриваться, открывать рот и шевелить пальцами.

Что касается показателей развития, то здесь стоит отметить созревание вилочковой железы, которая отвечает за выработку организмом лимфоцитов и развитие иммунитета. Гипофиз начинает вырабатывать гормоны, которые влияют на рост плода, обмен веществ организма и репродуктивную функцию организма. Печень эмбриона начинает вырабатывать желчь, которая будет помогать в переваривании пищи. Пищеварительная система готова переварить глюкозу.

Зародыш 12 недель весит около 9-13 грамм, плод вытянулся и находится в сидячем положении. Длина от темени до крестца составляет примерно 70-90 мм. Сердце эмбриона к этому сроку имеет четыре камеры: два предсердия и два желудочка, а частота сокращений варьируется от 150 до 160 ударов в минуту. Начинает формироваться костное небо, зачатки молочных зубов, а в гортани формируются голосовые связки.

Особенно важен этот период развития для мальчиков. В процессе активного действия тестостерона, который вырабатывается половыми железами мальчиков, начинают формирование наружные половые органы – половой член и мошонка. В случае нарушения этой функции может наблюдаться гермафродитизм.

Что чувствует мама в 12 недель беременности?

При нормальном течении беременности и развитии плода, беременная должна набрать от 1,8 до 3,6 кг. Норма прибавления в весе составляет от 300 до 400 грамм в неделю. При наборе веса больше нормы необходимо уменьшить количество простых углеводов (конфеты, печенье, халва и т.д.).

Многих женщин беспокоит появление на этом сроке пигментных пят на лице, шее, груди, а также появление темной линии от пупка до лобка. Однако беспокоиться не стоит, это нормальные проявления, и они вскоре поле родов пройдут.

Эмбрион в 12 недель успешно прошел эмбриональный путь жизни и после 12 недель называется плодом. В нашей статье будущая мама найдет для себя много полезной информации, чтобы получше узнать о своем будущем малыше.

Копчиково-теменной размер или КТР по неделям беременности, возможно, измерить только на первом обязательном скрининге. Этот диагностический показатель помогает не только установить срок гестации, но и предоставляет возможность судить о степени развития малыша внутри утробы.

Что означает КТР плода на узи при беременности?

КТР на узи при беременности – это основной параметр, определяющий величину и размер эмбриона. Измерения наиболее достоверны на этапе гестации от 10 до 16 недель. Раньше этого периода плод еще слишком мал для подобных измерений, позднее диагностический метод уже не такой информативный.

Понимание КТР при беременности дает возможность определить точный срок вынашивания. Благодаря копчико-теменному размеру врачи оценивают динамические показатели роста, рассчитывают вероятность формирования крупного плода, а также сравниваются риски по задержке внутриутробного развития.

На этапе ультразвукового скрининга специалисты проводят продольные замеры, которые не включают в себя конечности эмбриона. Не редко применяется трехкратное измерение, когда в течение 1 исследования делают три замера в период максимального разгибания младенца, но берут во внимание только усредненные размеры.

Срок беременности определяется в соответствии с некоторыми правилами:

  • показатель
  • > 10 мм + 6,5.
Таким образом, если копчико-теменной размер плода составляет 25 мм, то добавляют значение 65, а период гестации соответствует 9-ой акушерской неделе. Для расчета по дням применяется индекс равный 42, при этом размер исследуемого параметра не должен превышать 84 мм. Например, эмбрион 8 мм + 42 = 50 дней гестации. Погрешность ктр плода по неделям беременности составляет от 3 до 6 дней.

Таблица нормы ктр по неделям беременности

Размер ктр по неделям беременности с течением времени возрастает, так как плод растет и развивается. В случае проведения УЗИ несколько раз, то копчико-теменная длина изучается по динамическим свойствам, что позволяет исключить различные патологии.

Таблица нормы ктр по неделям беременности:

КРТ, мм Недели + дни КРТ, мм Недели + дни КРТ, мм Недели + дни
7 6+3 32 10 57 12+2
8 6+4 33 10+1 58 12+3
9 6+6 34 10+2 59 12+3
10 7 35 10+2 60 12+4
11 7+2 36 10+3 61 12+4
12 7+3 37 10+4 62 12+5
13 7+4 38 10+5 63 12+5
14 7+5 39 10+6 64 12+6
15 7+6 40 11 65 12+6
16 8 41 11 66 13
17 8+1 42 11+1 67 13
18 8+2 43 11+2 68 13+1
19 8+3 44 11+2 69 13+1
20 8+4 45 11+3 70 13+2
21 8+5 46 11+3 71 13+2
22 8+6 47 11+4 72 13+3
23 9 48 11+5 73 13+3
24 9+1 49 11+5 74 13+4
25 9+2 50 11+6 75 13+4
26 9+3 51 11+6 76 13+5
27 9+3 52 12 77 13+5
28 9+4 53 12+1 78 13+5
29 9+5 54 12+1 79 13+6
30 9+6 55 12+2 80 13+6
30 10 56

Если норма КТР больше срока, то зачастую это указывает на раннюю диагностику крупного плода. В таком случае врачи рекомендуют придерживаться определенных правил питания, а также не злоупотреблять лекарственными и поливитаминными комплексами.

Отклонения КТР в меньшую сторону

Чаще всего, при значительно сниженных показателях предусматривают неверно рассчитанный акушерский срок вынашивания. Овуляционный период и оплодотворение яйцеклетки, в этом случае, наступили позднее. Чтобы перепроверить данные назначают повторное обследование УЗИ по истечению примерно недели.

К другим отклонениям относятся:

  • остановившаяся в развитии беременность, когда эмбрион погибает внутри утробы, вследствие определенных патологических процессов. Диагноз ставится по отсутствию сердечных сокращений и двигательной активности. Ситуация требует незамедлительного оперативного вмешательства, чтобы не спровоцировать осложнения.
  • недостаточное продуцирование прогестерона или других гормонов может закончиться выкидышем. Назначается дополнительное УЗ-исследование и медикаментозная терапия с целью нормализации гормонального фона.
  • наличие инфекционных заболеваний также обуславливается нарушением роста и формированием ребенка. Проводятся дополнительные анализы, предусматривается лечение инфекции.
  • подозрение на нарушения генетического характера, связанные с различными синдромами, подтверждаются с помощью анализов 3-х маркеров – скрининг, ХГЧ и протеина-А.
Нормы ктр по неделям беременности один из главных показателей первого скрининга, исследование помогает оценить степень формирования плода внутри утробы и предпринять необходимые медицинские действия для улучшения патологический ситуации в случае диагностирования отклонений.

КТР (копчико-теменной размер) можно определить при сагиттальном сканировании путем измерения расстояния от темечка плода до копчика. Эта методика позволяет с максимальной точностью узнать возраст эмбриона и его размер. Опираясь на эти данные, медик может судить о росте и формировании плода, а также помочь избежать каких-либо отклонений.

КТР эмбриона на ранних стадиях

Для того чтобы результаты КТР были максимально точными, снимок плода необходимо сделать в тот период, когда он в более разогнутом состоянии . Расстояние измеряют от наиболее высокой точки темечка до копчика. Считается, что КТР является самым точным показателем, определяющим срок беременности, поскольку не зависит от расы, индивидуальных особенностей и пола ребенка.

Если копчико-теменной размер немного не соответствует необходимой норме, беспокоиться не нужно : эти результаты сравнивают с таблицей КТР по неделям беременности, а точно прогнозировать развитие ребенка, опираясь лишь на эти данные, нельзя. У каждого плода имеются свои физиологические особенности. Однако если КТР в период нескольких недель увеличивается, то возникает вероятность рождения ребенка с весом 4 или даже 6 кг.

Несмотря на то что показания КТР плода и таблицы не всегда совпадают, принимать во внимание её значения всё же стоит. Причинами большого КТР могут быть:

  • наличие у матери сахарного диабета;
  • ожирение у беременной;
  • употребление препаратов, способствующих метаболизму;
  • прием различных витаминных комплексов.

Больший размер эмбриона также является сигналом того, что будущая мама должна ограничить себя в чрезмерном употреблении пищи, повышающей холестерин. Более тяжёлым случаем является возникновение новообразований, то есть наличие врожденных дефектов.

Последствия неправильного развития плода

В большинстве случаев группа лекарственных препаратов провоцирует рост плода, причем до критических параметров. Находясь еще в утробе, ребёнок может весить более 5 кг. Принимая во внимания данные КТР таблицы по неделям, врачи на ранней стадии беременности могут скорректировать габариты плода.

Если КТР намного ниже табличного значения, то в большинстве случаев причиной может быть более поздний срок оплодотворения яйцеклетки. Для того чтобы подтвердить отсутствие каких-либо патологий, врачи назначают УЗИ.

В противном случае организм женщины, да и сам будущий ребенок, может сильно пострадать. Специалисты, установив причину и форму отклонения, могут вовремя оказать помощь и скорректировать развитие эмбриона.

В утробе матери ребенок растет и увеличивается в размере: каждый день на 1 или 2 мм. И это поможет сделать прогнозы показаний таблицы КТР плода по неделям и дням, определив норму отклонения, которая не должна превышать 3 дней. Поэтому начиная с 7-й недели беременности и до 15-й недели таблица является основным показателем роста ребенка. На 16-й неделе жизнь и развитие плода контролируются врачами при помощи УЗИ.

На 7-й неделе беременности максимальный размер от головы до копчика не должен превышать 11 мм, а среднее значение на 8-ю неделю составляет 14 мм. На 11-й неделе среднее значение КТР в идеале — 41 мм, а на 13-й — приблизительно 54−56 мм, не более 71 мм. Максимальное значение (95 процентиль) на 14-й неделе беременности не должно превышать 86 мм.

Поскольку значение КТР измеряется в миллиметрах, для того чтобы его самостоятельно рассчитать, калькулятор не нужен. В утробе матери ребенок должен расти и развиваться умеренно , в соответствии с установленными стандартами.

Рекомендуем также

Хомут оцинкованный с гайкой (КТР)

Хомут для медных труб с резиновым уплотнителем, гасящим вибрацию и гайкой для соединения с шуруп-шпилькой либо шпилькой.

Размеры хомутов от 15мм до 219мм. Размер гаек на хомутах М8/М10

Номинальный размер Условный про-ход трубы (Dy) Толщина и ши-рина полосы, мм Гайка Нагрузка, kH Цена за шт BYN сндс
3/8″ (15-18 мм) M8 10 1,5×20 М8 0,8 0,84
1″ (32-36 мм) M8 25 1,5×22 М8 0,8 1,04
1/2″ (20-24 мм) M8 15 1,5×20 М8 0,8 0,88
3/4″ (26-30 мм) М8 20 1,5×20 М8 0,8 0,95
1-1/4″ (40-46 мм) M8 32 1,5×22 М8 0,8 1,16
1-1/2″ (48-53 мм) M8 40 1,5×22 М8 0,8 1,22
2″ (60-64 мм) M8 50 1,5×22 М8 2,1 1,38
2-1/2″ (75-80 мм) M8/10 65 2×25 M8/10 2,1 1,87
3″(86-92 мм) M8/10 80 2×25 M8/10 2,1 2,02
3-1/2″(99-105 мм) M8/10 90 2×25 M8/10 2,1 2,29
4″ (112-117 мм) M8/10 100 2×25 M8/10 2,1 2,50
5″(139-144 мм) M8/10 125 2,5×25 M8/10 3 2,64
6″(163-173 мм) M8/10 150 2,5×25 M8/10 3 3,54
8″(200-219 мм) M8/10 200 2,5×25 M8/10 3 4,11

Ножницы электрогидравлические КТR-19 N KRENN

Резак для высокопрочного арматурного каната и стального троса Krenn KTR-19 N, арматурорез электрический,
канаторез — тросорез с защитной прозрачной пластиной. Макс.  диам.  арматурного каната 16 мм, 25 тс, 1,15кВт, 57 МПа.

 Диаметр каната, мм Ø  16 mm R=70 Kg/mm2
 Прочность арматуры, мПа  700(70 Kg/mm2)
 Напряжение сети  230V/50Hz
 Мощность мотора, Вт  1150W
 Создаваемое усилие, тонн  25 ton
 Оказываемое давление, бар  570 bar
 Вес инструмента, кг  15,9 kg
 Габаритные размеры, мм  480x140x235

 

Маркировка инструмента

  • Артикул инструмента 1.50.0127

  • Производитель инструмента Krenn

  • Страна производства Германия

  • Классификация инструмента Моноблочный электроинструмент с фиксированной головой

  • Наименование инструмента Ножницы электрогидравлические КТР-19 N KRENN

  • Категория инструмента Резак арматуры, Резак арматурный, Резчик аматуры, Резчик арматурный, Резак каната, Резак троса, Арматурорез, Канаторез, Тросорез

  • Конструкция инструмента Портативный, Переносной, Подвесной

  • Фиксация инструмента Ручной инструмент, Подвесной инструмент, Настольный инструмент

  • Назначение инструмента Резка металла, Резка стали, Резка арматуры, Резка прутка, Резка каната, Резка троса

Технические характеристики

  • Рабочее давление (бар) 570

  • Создаваемое усилие (тс) 25

  • Номинальная мощность (Вт) 1150

  • Источник питания Питание от сети 220В 50Гц

  • Параметры электросети (В/Гц) 230V/50Hz

  • Габаритные размеры, ДхШхВ (мм) 480x140x235

  • Вес (кг) 15.9

Свойства материала

  • Рабочий материал Канат, Трос

  • Макс. диаметр/толщина рабочего материала (мм) 16

  • Прочность материала (МПа) 700

Ключи трубные, разводные

Инструменты

Электроинструменты

Станки и оборудование

Измерительные инструменты

Пневмоинструменты

Оборудование для чистки и уборки

Ключи и отвёртки

Строительные ручные инструменты

Слесарные и столярные инструменты

Шарнирно-губцевый инструмент, кусачки

Резьбонарезные инструменты

Крепёж и метизы

Круги, диски для электроинструментов

Оснастка для сверления

Оснастка для строгания и пиления

Спецоснастка

Запчасти и аксессуары к электроинструменту и станкам

Хранение инструментов

Сад и огород

Уход за растениями

Садовая мебель

Растения

Поливочный инвентарь

Садовая химия

Садовый инвентарь

Садовая техника

Садовый декор

Стройматериалы

Стеновые отделочные материалы

Листовые и пиломатериалы

Металлоизделия и металлопрокат

Теплоизоляционные материалы

Кровельные материалы

Материалы для подготовки поверхностей

Строительные смеси

Строительные клеи

Лестницы

Двери

Окна

Кладочные и облицовочные материалы

Устройство стен и подвесного потолка

Тепло и звукоизоляционные материалы

Пленки строительные

Ливневая система

Строительные машины

Оборудование

Строительный инвентарь

Сварка и резка

Ремонт и декор

Напольные покрытия

Отделка стен и потолка

Специализированные покрытия

Сантехника

Унитазы

Ванны

Душевые кабины, уголки

Аксессуары для душа

Умывальники, раковины

Кухонные мойки

Смесители

Водонагреватели

Отопление дома

Внутренняя канализация

Наружная канализация

Насосы для канализации

Системы очистки воды

Вентиляция

Подводка, трубы

Люки, дверки сантехнические

Сифоны

Счётчики

Мебель и аксессуары для ванных комнат

Электрика и свет

Лампочки для дома

Домашние светильники

Светодиодное освещение

Садовые светильники

Промышленные лампы

Светильники для хозяйственных и общественных помещений

Фонари

Батарейки, аккумуляторы, источники питания

Системы безопасности

Удлинители

Розетки и выключатели

Тёплый пол электрический

Кабеленесущие системы

Кабели и провода

Электрооборудование

Электроприборы

Электромонтажные материалы

Связь, компьютеры

Бытовая техника

Кухонная техника

Встраиваемая кухонная техника

Техника для дома

Климатическая бытовая техника

Товары для дома

Стиральные моющие средства

Средства личной гигиены

Парфюмерно-косметические товары

Товары для уборки

Декор окон

Предметы декора и сувениры

Текстиль

Карнизы

Товары бытового назначения

Товары для ухода за одеждой, обувью

Посуда

Емкости для кухни

Упаковка

Новый год

Канцтовары

Товары для хобби

Товары для детей

Лаки и краски

Краски для внутренних работ

Лаки

Малярный инструмент

Добавки к лкм

Герметики, очистители

Деревозащитные средства

Клеи

Растворители

Грунты

Эмали

Краски для наружных работ

Спецодежда

Рукавицы, перчатки

Спецодежда

Сезонная одежда и обувь

Средства защиты

Автотовары

Автохимия

Автомобильная краска

Автокосметика

Оснастка и аксессуары для авто

Отдых и туризм

Товары для отдыха

Товары для спорта

Товары для бани

Печная продукция

Мебель

Мебель и товары для хранения

Кухни

Мебель для ванных комнат

Каркасные системы

Мебельная фурнитура

Дверная фурнитура, замки

Мебель для прихожих

Мебель офисная

драгоценных камней 39x26x7 мм 57,30 Crt mz1251 Ювелирные изделия из азурита Скидка 50% на натуральный Азурит Драгоценный камень с азуритом Скидка 50% на натуральный кабошон с азуритом по дизайну AAA

Модель средней посадки с обтекаемым силуэтом от бедра до проема для ног. Наш широкий выбор предлагает бесплатную доставку и бесплатный возврат. Из мягкой и удобной фланели из полиэстера. Носите как напоминание о том, что Бог есть Любовь.Бренд TooLoud (зарегистрированная торговая марка). Примерный размер: 7 мм х 7 мм. это великие моменты жизни. Печать: с использованием технологии сублимации красителя, 50 резьбовых и включает подходящую контргайку для легкой установки, aFe 30-10017 Воздушный фильтр: автомобильный. Интернет-магазин кухонных ножей и аксессуаров из большого выбора наборов столовых приборов. Мы уверены, что украшение вашего дома красным гобеленом — определенно ваш лучший выбор, свадебный выдвижной центральный аксессуар для вечеринки (1 шт.) (1 / уп.): Кухня и Питание.Черно-белая иллюстрация спирали морской ракушки на пляже Бутылка для воды — это экологически чистый способ носить с собой любимый напиток в школу. Глубокие гибкие канавки обеспечивают естественное движение. мы инвестируем в спортивную одежду и стремимся упростить для вас поиск спортивной одежды и одежды для фанатов, которую вы хотите, по отличной цене, бесплатную подарочную коробку лучшего качества и другие ремешки, ПОДПИСАННЫЕ вручную нашим мастером печати, чтобы гарантировать оригинал. Твердый микрозернистый карбид вольфрама премиум-класса C3 для инструмента промышленного качества с покрытием ZRN для повышенной прочности.Черно-белая полоса спереди и сзади с логотипом NFL, ПРЕДСТАВЛЯЕТ СВОЮ ШКОЛУ: Являетесь ли вы потенциальным троянцем или уже зачислены в Государственный университет Вирджинии, тип камня: кубический цирконий (Чехия). Этот кулон с родиевым покрытием является обязательным элементом вашей шкатулки для драгоценностей, трусы-боксеры высокого качества из 95% хлопка и 5% спандекса.

Драгоценные камни 39x26x7 мм 57,30 Crt mz1251 Ювелирные изделия из азурита Свободный азурит Драгоценный камень из азурита скидка 50% на натуральный ААА Desinger Азурит Кабошон

Купон на белую ткань боголан, Подкладка из лавандового понжи Сиреновая ткань для костюмов Подкладка из струящейся ткани Материал для подкладки из ветрозащитного понжи # 0302, BM14 Брэндон Мабли Shell Scape ДРЕСНЫЙ УГОЛЬ Kaffe Fassett Collective Designer Quilting Rowan Westminster Fasset 18 Лоскутная ткань для шитья, остатки винтажной хлопчатобумажной ткани .Набор аксессуаров Vintage Vogue Пояс Шарф Вуаль Повязка на голову Бантик Выкройка # 9576 PDF 11 x 17 Повторная печать МГНОВЕННАЯ ЗАГРУЗКА. Сделай сам Этническая маска Бусины в стиле Лэмпворк Стеклянные бусы Лэмпворк Тотемный столб Ханна Рознер Набор из 4 бусин Создайте свой собственный тотем. 3,5-4 мм 16 нитей Затененные сине-зеленые граненые бусины рондель TOURMALINE AA, Разноцветные бусины из балтийского янтаря с просверленным отверстием ~ 500 шт. — ширина от 0,15 до 0,23, 50 грамм 4-6 мм. Ожерелье Rondelle Shine, качество AAA, 1 нитка, драгоценный лабрадорит, драгоценный камень, ожерелье-390CTS, блестящее синее ожерелье с бусинами, элегантное ожерелье, 5шт, 10×12 мм, натуральный персик, лунный камень, овальный, кабошон….., 30 шт. Необработанный опал Мульти Огненный драгоценный камень Натуральный эфиопский опал Грубый полироль 3-6 мм Радуга Огненный опал Ювелирные изделия Бисероплетение Мульти Огненный грубый камень P9, цена за штуку. Натуральный Изумруд Сандавана Овальный Кабошон Свободный драгоценный камень Высочайшее качество 6 мм = 75 мм, разное количество Натуральный драгоценный камень для изготовления ювелирных изделий Размер 6×8 мм Черный рутил в форме груши Свободный граненый кабошон 5 шт. 10 шт. 15 шт. 20 шт., Эмаль, фурнитура для ювелирных изделий, серьги, стручки, 2019 F-331, серебро 925 пробы окисленное подвеска в виде стрекозы, серебряная подвеска со стрекозой, серебряная стрекоза, Ref: 2781 розовое золото 30 мм 100 или 200 гвоздь с головкой шарик розовое золото 50, 16 мм 2 шт. Узел с античной спиралью Колпачок Колпачки для клеевого шнура, подвеска Blank Antique Bronze, кабошон с купольным стеклом Поднос для подвесок Овальная установка кабошон Камея Установка кабошона Установка лицевой панели.Кулон Montana Glass Trilliant Cut СКИДКА 20% на 10шт. Позолота NP-993. Маленькие 1-дюймовые синие кианитовые лезвия ВЫБЕРИТЕ ВАШЕ КОЛИЧЕСТВО Кристалл Исцеляющий образец Ремесло Поставка ювелирных изделий Проволочная обертка Минерал.

Совместная транслокация ERp57 и кальретикулина определяет иммуногенность гибели клеток

Антитела и реагенты

Поликлональные (ab2907) и мышиные моноклональные (ab22683) антитела к CRT и кроличьи поликлональные антитела к ERp57 (ab10287) были получены от Abcam. .Для одновременного окрашивания CRT и ERp57 и некоторых вестерн-блотов использовали куриное анти-CRT антитело (ab61422) от Abcam. Мышиное моноклональное антитело против актина было от AbCys S.A. h3k b -FITC было от BD Pharmingen. Анти-GAPDH исходил от Abcam. Бацитрацин был приобретен у Sigma-Aldrich и использовался в концентрации 3 мМ за 30 мин до обработки метотрексатом.

Клетки, трансфекция и обработка

Клетки CT26 поддерживали в среде RPMI 1640, а HeLa и WT, crt — / — и erp57 — / — MEF культивировали в среде Игла, модифицированной Дульбекко (GIBCO ).Все среды были дополнены инактивированной нагреванием фетальной телячьей сывороткой (FBS), 10 мМ Hepes, 100 Ед / мл пенициллина и 100 мкг / мкг / мл стрептомицина. Для трансфекции crt — / — и erp57 — / — MEF клетки (1 × 10 5 клеток / лунка) высевали в 12-луночные планшеты и через 24 часа трансфицировали каждым вектором экспрессии. плазмиду с использованием липофектамина ™ 2000 (GIBCO BRL) в соответствии с инструкциями производителя. Клетки CT26 трансфицировали гетеродуплексами siRNA, специфичными для CRT (смысловая цепь: 5′-IndexTermrCrCrGrCUrGrGrGUrCrGrArAUrCrRrArATT-3 ‘) в конечной концентрации 100 нМ с использованием HiPerFect (Qiagen).Через 48 часов после трансфекции клетки CT26 оценивали на общее содержание CRT с помощью иммуноблоттинга. Для восстановления экто-CRT клетки инкубировали с recCRT, продуцированным в клетках насекомых, 2 при 3 μ г / 10 6 клеток в фосфатно-солевом буфере (PBS) на льду в течение 30 минут с последующими тремя промываниями. . Для кинетики воздействия CRT / ERp57 и оценки гибели клеток клетки обрабатывали в течение указанного времени, а затем промывали и инкубировали со свежей средой, не содержащей лекарств, до тех пор, пока они не были собраны через 20 часов после начальной обработки.

Конструирование плазмиды

Для конструирования кшРНК ERp57 были синтезированы самоотжигающиеся олигонуклеотиды, содержащие инвертированные повторы, разделенные спейсерной последовательностью и соответствующие нуклеотидам 521-541 кодирующей последовательности ERp57 мыши. Использовали следующие олигонуклеотиды: смысловой, 5′-IndexTermTCGA AGCCAGCAACTTGAGAGATAA GACTCCTGTTATCTCTCAAGTTGCTGGCTTTTTT-3 ‘; антисмысловой, 5’-IndexTermCTAGAAAAAGCCAGCAACTTGAGAGATAACAGGAGTCTTATCTCTCAAGTTGCTGGCT-3 ‘(цель в 21 нуклеотид подчеркнута).Эта миРНК ранее использовалась для подавления ERp57. 32 Олигонуклеотидов клонировали в вектор pSuppressorRetro (Imgenex, Сан-Диего, Калифорния, США), который несет промотор гена U6 и обеспечивает экспрессию shРНК. Скремблированная последовательность, предоставленная набором, использовалась в качестве контроля. Затем плазмиды shRNA трансфицировали вместе с упаковывающими векторами gag-pol и vsv-g в клетки HEK293T, и ретровирусные супернатанты концентрировали центрифугированием, как описано в инструкциях производителя.

Для создания изомеразно-мертвого ERp57 сайт-направленный мутагенез выполняли на кДНК ERp57 человека (GenBank # U42068) с использованием набора QuikChange (Stratagene). Мутации C57S и C406S были сконструированы с использованием следующих олигонуклеотидов соответственно: 5′-IndexTermTCTTCGCTCCCTGG AGT GGACACTGCAAG-3 ‘и 5’-IndexTermGAATTTTATGCCCCTTGG AGT GGTCATTG с подчеркиванием КДНК WT, одиночного мутанта C57S и двойного мутанта C57S / C406S ERp57 вырезали с помощью Eco RI и клонировали в pCMV-Tag3A (Stratagene) ниже и в рамке считывания эпитопа c-myc.

Создание стабильных клонов клеток shRNA

Для создания стабильных клонов клеток, экспрессирующих shRNA, клетки CT26 инфицировали ретровирусными частицами, несущими ERp57 или скремблированные плазмиды shRNA, и несколько клонов были выделены после отбора в генетицине (0,1 мг / мл) на 10 дней. Нокдаун ERp57 подтверждали вестерн-блоттингом.

Проточный цитометрический анализ CRT и ERp57 на поверхности клетки

Проточную цитометрию использовали для обнаружения воздействия CRT и ERp57, индуцированного светом MTX и UVC.Вкратце, 2 × 10 5 клеток высевали в 12-луночные планшеты и через день после обработки указанными агентами в течение 2 часов. Клетки собирали, дважды промывали PBS и фиксировали 0,25% параформальдегидом (PFA) в PBS в течение 5 мин. После повторной двукратной промывки в холодном PBS клетки инкубировали в течение 30 мин с первичным антителом, разбавленным холодным блокирующим буфером (2% FBS в PBS), с последующей промывкой и инкубацией с FITC-конъюгированным моноклональным или поликлональным вторичным антителом, разведенным 1: 500. в блокирующем буфере (30 мин).Затем каждый образец анализировали с помощью FACScan (Becton Dickinson) для идентификации CRT на клеточной поверхности и ERp57. Соответствующие изотипу антитела IgG использовали в качестве контроля, и интенсивность флуоресценции окрашенных клеток определяли по PI- или 4 ‘, 6-диамидино-2-фенилиндол (DAPI) -отрицательным клеткам.

Иммунофлуоресценция

Для окрашивания поверхности клетки культивировали на круглых стеклянных покровных стеклах диаметром 13 мм, как описано выше. После обработки клетки помещали на лед, дважды промывали PBS и фиксировали 0,25% PFA в PBS в течение 5 мин.Затем клетки дважды промывали PBS и добавляли первичное антитело, разбавленное холодным блокирующим буфером, на 30 мин. После трех промывок в холодном PBS клетки инкубировали в течение 30 мин с соответствующим вторичным антителом, разведенным 1: 500 в холодном блокирующем буфере. Клетки промывали PBS и помещали на предметные стекла с монтажной средой, включая DAPI от Vectashield. Для внутриклеточного окрашивания клетки промывали PBS, фиксировали 4% PFA в течение 20 минут, повышали проницаемость 0,1% Triton X-100 в течение 10 минут, трижды промывали PBS и сайты неспецифического связывания блокировали 10% FBS в PBS в течение 30 минут. мин.Первичное антитело добавляли на 1 час. Затем клетки трижды промывали PBS и инкубировали в течение 30 мин в Alexa Fluor FITC или 568-конъюгированных вторичных антителах (1: 1000; молекулярные зонды). Липидные рафты были обнаружены с помощью субъединицы В токсина холеры, конъюгированной с Alexa 488 (Invitrogen), в соответствии с инструкциями производителя перед фиксацией и окрашиванием CRT. Флуоресцентную микроскопическую оценку выполняли с помощью конфокального микроскопа Leica (AF6000).

Вестерн-блоттинг

Клетки собирали и гомогенизировали в буфере для лизиса RIPA (10 мМ Трис, pH 7.2, 150 мМ NaCl, 1% дезоксихолата, 1% Тритона X-100, 0,1% SDS, 5 мМ ЭДТА), содержащий полный коктейль ингибиторов протеазы (Roche Diagnostics, Meylan, Франция). Через 1 час на льду образцы обрабатывали ультразвуком и проводили количественный анализ белка с помощью анализа белка Bio-Rad. Равные количества растворимых белков (15-25 г) денатурировали кипячением и разделяли электрофорезом в полиакриламидном геле с додецилсульфатом натрия (SDS-PAGE) и переносили на нитроцеллюлозную мембрану. После блокирования в 5% обезжиренном сухом молоке в PBS в течение 1 часа и зондирования специфическим первичным антителом и вторичным антителом, конъюгированным с пероксидазой хрена, белковые полосы были обнаружены с помощью хемилюминесценции (суперсигнал, пирс) и экспонирования рентгеновской пленки ( Кодак).Загрузку белка нормализовали с использованием антител против GAPDH или против актина.

Оценка апоптоза

Перераспределение PM фосфатидилсерина является маркером апоптоза и оценивается с помощью флуоресцеина изотиоцианата аннексина (MACS, Miltenyi Biotech). 33, 34 Вкратце, собирали 2 × 10 5 клеток на образец, промывали в PBS, осаждали и ресуспендировали в инкубационном буфере (10 мМ Hepes / NaOH, pH 7,4, 140 мМ NaCl, 5 мМ CaCl 2 ) содержащий 1% аннексина V и ИП.Образцы хранили в темноте и инкубировали в течение 15 минут перед добавлением еще 400 мкл буфера для инкубации и последующим анализом на проточном цитометре Calibur с активированным флуоресценцией клеток (Becton Dickinson) с использованием программного обеспечения Cell Quest.

Биотинилирование и иммунопреципитация белков клеточной поверхности

Биотинилирование и восстановление белков клеточной поверхности проводили методом, адаптированным из Gottardi et al. 35 и Hanwell et al. 36 Вкратце, 20 × 10 6 клеток HeLa, выращенных на 75 см. 2 колбы помещали на лед и трижды промывали ледяным PBS-Ca 2+ -Mg 2+ (PBS с 0,1 мМ CaCl 2 и 1 мМ MgCl 2 ). Затем мембранные белки биотинилировали путем 30-минутной инкубации при 4 ° C с 1,25 мг / мл NHS-SS-биотина (Pierce), недавно разведенного в буфере для биотинилирования (10 мМ триэтаноламин, 2 мМ CaCl 2 , 150 мМ NaCl, pH 7.5) с легким встряхиванием.Клетки CT26 промывали PBS-Ca 2+ -Mg 2+ + глицин (100 мМ) и промывали в этом буфере в течение 20 минут при 4 ° C, чтобы погасить непрореагировавший биотин. Затем клетки дважды промывали PBS-Ca 2+ -Mg 2+ , соскребали холодным PBS и осаждали при 2000 об / мин. при 4 ° C. Осадки солюбилизировали в течение 45 мин в 200 мкл мкл лизирующего буфера (1% Triton X-100, 150 мМ NaCl, 5 мМ EDTA, 50 мМ Трис, pH 7,5), содержащего ингибиторы протеаз. Лизаты осветляли центрифугированием при 14000 × g в течение 10 минут при 4 ° C, и супернатанты инкубировали в течение ночи с анти-CRT (мышиным моноклональным) антителом или совпадающим по изотипу контрольным антителом (мышиный IgG2a).Затем образцы инкубировали в течение ночи с упакованными гранулами стрептавидин-агарозы для извлечения биотинилированных белков. Затем шарики осаждали центрифугированием и отбирали аликвоты супернатантов, чтобы представить несвязанный внутриклеточный пул белков. Биотинилированные белки элюировали из шариков путем нагревания до 100 ° C в течение 5 минут в буфере для образцов SDS-PAGE перед нанесением на 4–12% градиентный гель бис-трис (Invitrogen). Кроличьи поликлональные антитела ERp57 использовали для обнаружения взаимодействия CRT-ERp57 с помощью иммуноблоттинга.Чтобы гарантировать отсутствие утечки биотина в клетки, мы проверили отсутствие внутриклеточного белка актина в биотинилированных экстрактах.

Двумерный гель-электрофорезный анализ и идентификация белков с помощью масс-спектрометрии

Очищенные белки, осажденные с использованием набора для очистки Ettan 2-D (GE Healthcare), впоследствии ресуспендировали в буфере мочевины (7 M мочевина, 2 M тиомочевина, 2% Chaps , 1% сульфобетаин SB3-10, 1% амидосульфобетаин ASB14, 50 мМ дитиотреитол). Для первого измерения разделения белков изоэлектрическое фокусирование выполняли с использованием 18-сантиметровых полос с иммобилизованным нелинейным градиентом pH (pH 3–10; GE Healthcare) на приборе для электрофореза IPGphor II (GE Healthcare).Белки (100 мкМ г) загружали регидратацией в геле в течение 9 часов с использованием низкого напряжения (30 В), а затем запускали с использованием программы, в которой напряжение было установлено в течение 1 часа при 100 В, 2 часа при 200 В. V, 1 час при 500 В, 1 час при 1000 В, 2 часа при 1000–8000 В и 4 часа при 8000 В. Перед электрофорезом второго измерения полоски геля IPG уравновешивали в течение 10 минут при комнатной температуре в 1% дитиотреитоле. для восстановления белков и сульфгидрильных групп были впоследствии дериватизированы с использованием 4% йодацетамида (оба раствора были приготовлены в 50 мМ Трис (pH 8.8) –6 M мочевина – 30% глицерина – 2% SDS – 2% бромфенолового синего). Полоски переносили в 10% (вес / объем) полиакриламидные гели толщиной 1,0 мм (20 на 20 см) и гели второго измерения прогоняли при 50 μ A в течение 6 часов. Гели окрашивали Sypro Ruby (Bio-Rad) и визуализировали с помощью сканера Typhoon 9200 (GE Healthcare). Анализатор Investigator HT (Genomic Solutions Inc.) использовали для сопоставления и анализа визуализированных белковых пятен среди дифференциальных гелей. Вычитание фона использовали для нормализации значения интенсивности, представляющего количество белка на пятно.

Дифференциально экспрессируемые пятна вырезали из гелей автоматическим сборщиком пятен (Investigator ProPic, Genomic Solutions Inc.), помещали в пробирки Эппендорфа и обесцвечивали промыванием в течение 5 мин 50 мкл л 0,1 М NH 4 HCO 3 . Затем добавляли 50 мкл мкл 100% ацетонитрила и инкубировали еще 5 мин. Жидкость сливали, этапы промывки повторяли еще раз, и гелевые пробки уменьшали за счет добавления чистого ацетонитрила.Кусочки высушенного геля повторно набухали с 4,0 нг / мкл л трипсина (Promega, Мэдисон, Висконсин, США) в 50 мМ NH 4 HCO 3 и расщепляли в течение ночи при 37 ° C. Пептиды концентрировали с помощью наконечников для пипеток ZipTip ® μ C18. Совместное элюирование проводили непосредственно на мишени MALDI с 1 мкл мкл матрицы α -циано-4-гидроксикоричной кислоты (5 мкг г / мл в 50% ацетонитриле, 0,1% TFA). MALDI-MS и MALDI-MS / MS были выполнены на анализаторе протеомики Applied Biosystems 4700 с ионной оптикой TOF / TOF.Спектры были получены в режиме положительного МС-отражателя и откалиброваны либо снаружи с использованием пяти пиков стандарта (калибровочная смесь ABI4700), либо внутри с использованием пиков пептида автолиза свиного трипсина (842,51, 1045,56 и 2211,10 [M + H] + ионов). Масс-спектры были получены для каждого пятна образца путем накопления 30 субспектров (каждый из которых состоит из 50 лазерных выстрелов) в диапазоне масс 750–4000. Для анализа МС / МС были отобраны пять лучших пиков отношения сигнал / шум каждого спектра. Для спектров MS / MS энергия столкновения составляла 1 кэВ, а газом столкновения был воздух. 37

Данные MS и MS / MS были интерпретированы с помощью программного обеспечения GPS Explorer (версия 2.1, Applied Biosystems), которое действует как интерфейс между базой данных Oracle, содержащей необработанные спектры, и локальной копией поисковой системы MASCOT (версия 1.8 ). Отпечатки пептидных масс, полученные в результате анализа масс-спектрометрией, использовали для идентификации белков в неизбыточной базе данных Swiss Prot. Все значения массы пептида считаются моноизотопными, и допуск по массе был установлен на уровне <50 частей на миллион. В качестве фермента переваривания использовали трипсин, допускался один пропущенный сайт расщепления, предполагалось, что метионин частично окислен, а серин, треонин и тирозин частично фосфорилированы.Оценка Mascot (Matrix Science) более 71 считалась значимой ( P <0,005). Для анализа МС / МС все пики с отношением сигнал / шум более 5 были найдены в базе данных Swiss Prot с использованием тех же модификаций, что и в базе данных МС. Рассмотрена толерантность к фрагментам менее 0,3 Да.

Штаммы дрожжей и условия роста

Штаммы (ATCC201388 MAT a his31 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 ) с GFP-tagged Cne1p и Pdi1p исследования были получены от Invitrogen.Для исследований совместной локализации штаммы BY4741 ( MAT a his3 Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 ) WT и BY4742 ( MAT a ; his3 Δ 1 leu2 Δ 0 lys2 Δ 0 ura3 Δ 0 ) из ​​коллекции штаммов Euroscarf. Cne1p в штамме BY4741 был помечен тегом GFP, а Pdi1p в штамме BY4742 был помечен тегом YFP.Все штаммы выращивали на среде SC, содержащей 0,17% азотистого основания дрожжей (Difco), 0,5% (NH 4 ) 2 SO 4 и 30 мг / л всех аминокислот (кроме 80 мг / л гистидина и 200 мг / л). мг / л лейцина), 30 мг / л аденина и 320 мг / л урацила с 2% глюкозы в качестве источника углерода. Штаммы выращивали при 28 ° C.

Штаммы (ATCC201388 MAT a his31 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 ) с меченными GFP Cne1p и Pdi1p были использованы для получения нескольких штаммов с нокаутом.Нокауты были построены согласно Gueldener et al. 38 с использованием pUG72 в качестве шаблона для разрушающей кассеты URA3 .

Белки Cne1p и Pdi1p в штаммах BY4741 и BY4742 были помечены либо eGFP, либо YFP. Мечение было выполнено согласно Sheff and Thorn, 39 с использованием оптимизированного набора кассет GFP, приобретенных у Euroscarf (pKT209 для мечения GFP и pKT90 для мечения YFP). Штамм BY4741 с Cne1p, меченным GFP на С-конце, был скрещен с BY4742, несущим Pdi1p, меченный YFP на С-конце.После споруляции тетрады препарировали с помощью микроманипулятора (Singer Instruments) и споры, экспрессирующие как Cne1p-GFP, так и Pdi1p-YFP, исследовали под микроскопом. Для этого клетки выращивали при 28 ° C в синтетической полной среде и обрабатывали 10 мкл М МТХ в течение 4 часов. После различных периодов инкубации в присутствии лекарственного средства клетки просматривали с помощью флуоресцентной микроскопии с использованием тонкополосного фильтра eGFP или фильтров YFP (Zeiss) на микроскопе Zeiss Axioskop.

Клоногенные анализы

Клетки CT26 (800 клеток / лунку) высевали в двух или трех повторностях в шестилуночные планшеты.После присоединения клеток их обрабатывали 20 и 200 нМ метотрексата в течение 24 часов с последующей заменой среды новой средой без лекарств. Клетки культивировали до 14 дней. Колонии фиксировали и окрашивали кристаллическим фиолетовым. Затем подсчитывали все колонии из 50 или более клеток.

Противоопухолевая вакцинация и оценка роста опухоли

in vivo

Все животные содержались в определенных условиях, свободных от патогенов, и все эксперименты следовали рекомендациям Федерации Европейской ассоциации лабораторных животных.Все эксперименты на животных были одобрены Этическим комитетом Института Густава Русси (IGR). 3 × 10 6 клеток CT26, необработанных или обработанных метотрексатом в течение 4 часов, инокулировали подкожно в 200 мкл мкл PBS в нижний бок самок мышей BALB / c в возрасте 6 недель (Janvier), тогда как 5 × 10 5 необработанных контрольных клеток инокулировали на контралатеральном фланге. 1 Для анализа канцерогенности 3 × 10 6 обработанных или необработанных клеток CT26 инъецировали подкожно мышам nu / nu (зоопарк IGR).Опухоли контрольной стороны оценивали еженедельно с помощью штангенциркуля. Животных с опухолями, превышающими 20-25% массы тела, умерщвляли. В серии экспериментов BALB / c (WT или nu / nu ), несущий пальпируемые опухоли CT26 (имплантированные за 10 дней до этого путем инъекции 10 6 опухолевых клеток), получали однократную внутриопухолевую инъекцию PBS или 100 мкл мкл. PBS, содержащий такую ​​же концентрацию МТХ, что и использованный in vitro или 100 мкл мкл PBS, содержащего МТХ и рек.ЭЛТ (15 мкм г). Размер опухолей оценивали каждые 4 дня с помощью штангенциркуля. Ни один из этих методов лечения не вызвал макроскопического некроза.

Сочетание конечного диастолического диаметра левого желудочка и продолжительности QRS однозначно предсказывает хороший ответ и прогноз сердечной ресинхронизирующей терапии

Предпосылки . Приблизительно 20-40% получателей сердечной ресинхронизирующей терапии (СРТ) не отвечают на нее в соответствии с текущими критериями отбора пациентов. Цель этого исследования состояла в том, чтобы определить исходные параметры, которые могут предсказать ответ на СРТ, и оценить влияние этих прогностических параметров на долгосрочный прогноз. Методы . Это было ретроспективное, нерандомизированное, неконтролируемое когортное исследование. Пациенты, получившие CRT в нашем центре, были разделены на респондентов и неответчиков по определению ответа CRT (увеличение фракции выброса левого желудочка (LVEF) ≥5% и улучшение ≥1 класса New York Heart Association (NYHA) от исходного уровня до 6-месячное наблюдение). Результатов . Из 101 пациента 68 ответили и 33 не ответили. Конечный диастолический диаметр левого желудочка (LVEDD; OR: 0.88, 95% ДИ: 0,81–0,95) и продолжительность QRS (ОШ: 1,07, 95% ДИ: 1,04–1,10,) были независимыми предикторами ответа на CRT. Комбинация LVEDD и продолжительности QRS была более ценной для прогнозирования ответа на CRT (AUC 0,836; 95% ДИ: 0,76–0,91;). Более того, комбинация LVEDD ≤ 71 мм и продолжительности QRS ≥ 170 мс имела низкую частоту смертности от всех причин, госпитализацию HF и комбинированную конечную точку. Кроме того, исходный LVEDD имел положительную корреляцию с продолжительностью QRS (,). У респондентов на CRT было лучше обратное ремоделирование ЛЖ. Заключение . Комбинация LVEDD и продолжительности QRS обеспечила более надежное прогнозирование ответа CRT. Более того, комбинация LVEDD ≤ 71 мм и продолжительности QRS ≥ 170 мс была связана с низкой частотой летальности от всех причин, госпитализацией с сердечной недостаточностью и комбинированной конечной точкой. Наши результаты могут быть полезны для обеспечения индивидуального отбора пациентов для СРТ.

1. Введение

Сердечная ресинхронизирующая терапия (CRT) — это эффективная терапия для пациентов с сердечной недостаточностью (HF) со сниженной фракцией выброса левого желудочка (LVEF) и задержкой внутрижелудочковой проводимости.Крупные клинические испытания показали, что CRT улучшает сердечную функцию, симптомы сердечной недостаточности, переносимость физической нагрузки и качество жизни, а также снижает количество госпитализаций, связанных с сердечной недостаточностью, и снижает смертность [1–4]. К сожалению, степень ответа на СРТ не одинакова для всех пациентов. Примерно 20–40% пациентов не демонстрируют существенной пользы от СРТ в диапазоне, зависящем от определения ответа, используемого для «неответчиков» [5]. Таким образом, определение надежных предикторов ответа до имплантации CRT с использованием неинвазивных инструментов остается серьезной проблемой, с которой сталкиваются исследователи.Целью настоящего исследования было определить исходные параметры, которые могут предсказать ответ на СРТ в течение 6-месячного периода наблюдения, и оценить влияние этих прогнозных параметров на смертность от всех причин или госпитализацию, связанную с сердечной недостаточностью.

2. Материалы и методы
2.1. Отбор пациентов

С января 2014 г. по декабрь 2018 г. 118 последовательных пациентов с застойной сердечной недостаточностью получали СРТ. Пациенты, которым не проводилась контрольная эхокардиография в течение 6 месяцев для определения изменений ФВЛЖ, в исследование не включались ().Таким образом, в настоящее ретроспективное, нерандомизированное, неконтролируемое когортное исследование был включен 101 пациент. Критериями включения были развитая сердечная недостаточность от II до IV класса Нью-Йоркской кардиологической ассоциации (NYHA), несмотря на оптимальную медикаментозную терапию ≥3 месяцев, фракцию выброса левого желудочка (ФВЛЖ) ≤ 35% и продолжительность QRS ≥ 130 мс. Исследование было одобрено Советом по этике клинических исследований Третьего военно-медицинского университета (Армейский медицинский университет). Все пациенты, которые были знакомы с процессами и целями исследования, согласились участвовать в этом исследовании и подписали информированное согласие.

2.2. Имплантация CRT

Положение отведения левого желудочка (ЛЖ) было выбрано для достижения удовлетворительных параметров стимуляции без стимуляции диафрагмального нерва. Через коронарный синус отведение ЛЖ продвигалось к боковой или заднебоковой вене. Если не было доступной боковой или заднебоковой вены, рассматривалась большая сердечная вена или средняя сердечная вена. Правый желудочковый электрод имплантировали в верхушку правого желудочка, а правый предсердный электрод помещали в правое предсердие.

2.3. Эхокардиография

Всем пациентам проводилась эхокардиография перед имплантацией СРТ и через 6 месяцев наблюдения. Изображения были получены с использованием имеющейся в продаже системы (Vivid 7, General Electric-Vingmed, США). Параметры эхокардиографии включали ФВЛЖ (рассчитано с использованием модифицированной формулы Симпсона), площадь митральной регургитации (MR; оценивается полуколичественно), диаметр левого предсердия (LAD) и конечный диастолический диаметр левого желудочка (LVEDD; измеряется в M-режиме).

2.4. Определение блока левой ножки пучка (LBBB), блока правой ножки пучка (RBBB) и ответа CRT

БЛНПГ была диагностирована в соответствии с общепринятыми критериями, а именно длительностью QRS ≥ 120 мс с комплексом QS или rS в отведении V1 и монофазным Зубец R без зубца Q в отведении V6 [6, 7].

БПНПГ определялась как длительность QRS ≥120 мс с глубоким концом зубца S в отведениях I и V6 и rSR ’, rsR’ или rsr ’в отведении V1 или V2 [6, 7] .

Ответ CRT был определен как увеличение LVEF ≥ 5% и улучшение ≥1 класса NYHA от исходного уровня до 6-месячного периода наблюдения [8, 9].

2,5. Определение комбинированной конечной точки

Составной конечной точкой была определена смертность от всех причин или госпитализация по поводу сердечной недостаточности.

2.6. Статистический анализ

Анализы выполняли с использованием SPSS версии 19.0 (SPSS Inc., США) и MedCalc версии 18.6.0 (MedCalc Inc., Бельгия). Непрерывные переменные были представлены как среднее ± стандартное отклонение или медиана (межквартильный размах). Категориальные переменные были представлены в виде чисел с процентами. Различия между параметрическими переменными оценивались с помощью теста Стьюдента t , а различия между непараметрическими переменными оценивались с помощью теста Манна-Уитни U .Различия между категориальными переменными оценивались с помощью точного критерия Фишера или критерия хи-квадрат. Обратную пошаговую многомерную логистическую регрессию выполняли с использованием переменных с в одномерной логистической регрессии. Кривая рабочих характеристик приемника (ROC) использовалась для визуализации значений переменных, которые могли независимо предсказывать ответ в многомерном анализе, а оптимальное значение отсечки было определено как наивысший уровень (чувствительность — (1 — специфичность)). Связь между LVEDD и продолжительностью QRS оценивалась с помощью анализа линейной регрессии.Кривые Каплана-Мейера с лог-ранговыми тестами были построены для оценки значительных различий в встречаемости конечных точек. Двусторонний считался статистически значимым.

3. Результаты
3.1. Исходные характеристики

Из 101 пациента (средний возраст 61,22 ± 9,54 года) в настоящем исследовании 68 (67,3%) считались респондентами, а 33 (32,7%) не отвечали. В исследование были включены 70 (69,3%) мужчин и 31 (30,7%) женщина. Более того, 62 пациента имели БЛНПГ, 3 пациента — БПНПГ и 21 пациент — задержку внутрижелудочковой проводимости (IVCD).

Как показано в Таблице 1, респонденты имели значительно меньшую ПМЖВ (), меньшую КЭДРЛ () и большую продолжительность QRS () и чаще страдали от БЛНПГ (), чем не ответившие. Однако не было значительных различий в возрасте, поле, натрийуретическом пептиде головного мозга (BNP), классе NYHA, продолжительности сердечной недостаточности, гипертонии, хронической почечной дисфункции (CRD), ишемической кардиомиопатии (ICM), ФВ ЛЖ, MR и среднем времени наблюдения. между двумя группами.

22 ± 9,54

Характеристики Общая популяция () Респонденты () Неответчики () значение
61,65 ± 10,39 60,33 ± 7,55 0,473
Пол (женский) 31 (30,7%) 19 (27,9%) 12 (36,4%) 12 (36,4%)
BNP (нг / л) 401 (213–1185) 321 (181,3–1129) 685 (325,5–1230) 0,537
Класс NYHA
II 21 (20.8%) 15 (22,1%) 6 (18,2%) 0,652
III 60 (59,4%) 40 (58,8%) 20 (60,6%) 0,864
IV 20 (19,8%) 13 (19,1%) 7 (21,2%) 0,804
Продолжительность HF (мес.) 48 (12–72) 30 (12 –72) 60 (30–96) 0,192
Гипертония, n (%) 21 (20.8%) 15 (22,1%) 6 (18,2%) 0,652
CRD, n (%) 18 (17,8%) 11 (16,2%) 7 ( 21,2%) 0,535
ICM, n (%) 17 (16,8%) 12 (17,6%) 5 (15,2%) 0,756
LVEF (%) 29,40 ± 4,42 29,56 ± 4,10 29,08 ± 5,06 0,609
LAD (мм) 44.39 ± 5,48 43,41 ± 5,20 46,43 ± 5,58 0,009
LVEDD (мм) 70,06 ± 7,84 68,68 ± 7,38 72,91 MR (см 2 ) 7,2 (4,5–10,4) 7,2 (4,5–10,4) 7,5 (4,4–10,4) 0,278
Длительность QRS (мс) 165,30 ± 21,33 171,20 ± 21,56 153.30 ± 15,07 <0,001
LBBB, n (%) 62 (61,4%) 47 (69,1%) 15 (45,5%) 0,022
Среднее время наблюдения (мес.) 23,76 ± 14,48 23,60 ± 14,83 24,09 ± 13,95 0,875

Значения средние, средний диапазон или n (%).BNP: натрийуретический пептид мозга; NYHA: Нью-Йоркская кардиологическая ассоциация; HF: сердечная недостаточность; ХБП: хроническая почечная дисфункция; ICM: ишемическая кардиомиопатия; ФВЛЖ: фракция выброса левого желудочка; LAD: размер левого предсердия; LVEDD: конечный диастолический размер левого желудочка; МРТ: митральная регургитация; LBBB: блокада левой ножки пучка Гиса.

3.2. Шестимесячное наблюдение

По сравнению с неответчиками, у респондентов, ответивших на CRT, были более значительные изменения в ФВЛЖ, LVEDD, MR и продолжительности QRS от исходного уровня до 6-месячного наблюдения.Однако не наблюдалось значительных различий в изменениях ПМЖВ между респондентами и неответчиками (Таблица 2).

Изменение в (−4) –4]

Переменные Респонденты () Неответчики () значение

EF 2 <0,001
Изменение LAD −3.2 [(−6) –0] −3,5 [(−7) –1,5] 0,649
Изменение LVEDD −6 [(−15) — (- 2)] 0 [ (−3,5) –4,5] <0,001
Изменение MR −4,5 [(−7,2) — (- 1,6)] −2,1 [(−5,1) –2,2] 0,008
Изменение длительности QRS −34,13 ± 25,69 −19,26 ± 24,81 0,009

левый желудочек LAD: размер левого предсердия; LVEDD: конечный диастолический размер левого желудочка; МР: митральная регургитация.

3.3. Предикторы для ответа на CRT

Обратный пошаговый многомерный анализ показал, что LVEDD (OR: 0,88, 95% CI: 0,81–0,95) и продолжительность QRS (OR: 1,07, 95% CI: 1,04–1,10,) были независимыми предикторами ответа. (Таблица 3).

0,0352 0,0352

Одномерный анализ Многомерный анализ
Базовые характеристики OR (95% ДИ) значение значение OR значение OR (значение )
Возраст 1.02 (0,97–1,06) 0,515
Пол 1,47 (0,61–3,57) 0,391
1.00352
1.00357
Класс NYHA 0,86 (0,45–1,66) 0,659
Продолжительность HF 1,00 (0,99–1,00) 1.27 (0,44–3,25) 0,653
CRD 0,72 (0,25–2,06) 0,536
ICM
LVEF 1,03 (0,93–1,13) 0,605
LAD 0,90 (0,83–0,98) 4 (0,85–1,04) 0,237
LVEDD 0,93 (0,88–0,99) 0,014 0,88 (0,81–0,95) 0,001 –1,04) 0,293
Продолжительность QRS 1,05 (1,03–1,08) < 0,001 1,07 (1,04–1,10)
2.69 (1,14–6,33) 0,024 1,71 (0,60–4,88) 0,315

OR: отношение шансов; 95% ДИ: 95% доверительный интервал. BNP: натрийуретический пептид мозга; NYHA: Нью-Йоркская кардиологическая ассоциация; HF: сердечная недостаточность; ХБП: хроническая почечная дисфункция; ICM: ишемическая кардиомиопатия; ФВЛЖ: фракция выброса левого желудочка; LAD: размер левого предсердия; LVEDD: конечный диастолический размер левого желудочка; МРТ: митральная регургитация; LBBB: блокада левой ножки пучка Гиса.

Анализ кривой ROC показал, что площадь под кривой (AUC) для исходного LVEDD составляла 0,662 (95% ДИ: 0,55–0,77,), при LVEDD ≤ 69 мм, что имеет чувствительность 62%, специфичность 73%, 82 % положительного значения прогноза (PPV) и 48% значения отрицательного прогноза (NPV). Для продолжительности QRS AUC составляла 0,744 (95% ДИ: 0,65–0,84), при длительности QRS ≥ 166 мс, имея 62% чувствительность, 82% специфичность, 88% PPV и 51% NPV. LVEDD ≤ 71 мм в сочетании с длительностью QRS ≥ 170 мс имели 65% чувствительность, 97% специфичность, 98% PPV и 57% NPV для прогнозирования ответа (AUC 0.836; 95% ДИ: 0,76–0,91; ). Комбинация LVEDD и продолжительности QRS была более ценна для прогнозирования ответа, чем LVEDD (AUC, 0,836 против 0,662;;) или длительность QRS (AUC, 0,836 против 0,744;;) отдельно. Однако не было разницы между значением LVEDD и продолжительностью QRS при прогнозировании ответа на CRT (AUC, 0,662 против 0,744;;) (Таблица 4, Рисунок 1).

Специфичность (%)

Переменные AUC 95% CI для AUC Пороговое значение Чувствительность (%) NPV (%)

LVEDD (мм) 0.662 0,55–0,77 0,004 ≤69 62 73 82 48
Длительность QRS (мс) 0,744 ≥166 62 82 88 51
Сочетание длительности LVEDD и QRS (мм, мс) 0,836 0,76–0,91 71 <D 0,00 и ≥170 65 97 98 57

LVEDD: конечный диастолический размер левого желудочка; AUC: площадь под кривой; 95% ДИ: 95% доверительный интервал; PPV: положительное значение прогноза; NPV: отрицательное значение прогноза.


Кроме того, исходный LVEDD имел положительную корреляцию с продолжительностью QRS (,).

3.4. Долгосрочный прогноз

Долгосрочное наблюдение проводилось путем телефонного интервью или посещения клиники. В течение среднего периода наблюдения 23,76 ± 14,48 месяцев комбинированная конечная точка наблюдалась у 35 пациентов (13 смертей и 22 госпитализации по поводу сердечной недостаточности). Частота комбинированной конечной точки составила 40% (14 с 4 смертельными исходами и 10 госпитализаций по поводу сердечной недостаточности) у респондентов и 60% у не респондентов (21 с 9 смертельными случаями и 12 госпитализациями).Кривые Каплана-Мейера показали, что кумулятивная частота комбинированной конечной точки или только смертности от всех причин была значительно ниже у респондентов, пациентов с КЭДЛЖ ≤ 69 мм и пациентов с сочетанием КЭДЛЖ ≤ 71 мм и продолжительностью QRS ≥ 170 мс. Более того, конечная точка госпитализации только с HF была значительно менее вероятна у респондентов и пациентов с комбинацией LVEDD ≤ 71 мм и продолжительностью QRS ≥ 170 мс. Однако не наблюдалось разницы между группой с длительностью QRS ≥ 166 мс и группой с длительностью QRS <166 мс по совокупной частоте комбинированной конечной точки, только смертности от всех причин или только госпитализации с сердечной недостаточностью (Рисунок 2, Дополнительные рисунки 1 и 2).

4. Обсуждение

В настоящем исследовании мы продемонстрировали, что LVEDD и продолжительность QRS были независимыми предикторами ответа на CRT и что комбинация LVEDD и продолжительности QRS была более эффективной для прогнозирования ответа. Более того, совокупная частота комбинированной конечной точки была статистически ниже у респондеров, пациентов с КЭД ЛЖ ≤ 69 мм и комбинированных пациентов с КЭД ЛЖ ≤ 71 мм и продолжительностью QRS ≥ 170 мс. Более того, исходный LVEDD имел положительную корреляцию с продолжительностью QRS.Кроме того, у пациентов, ответивших на CRT, было лучше обратное ремоделирование ЛЖ.

Предыдущее исследование Achilli et al. показали, что меньший конечный систолический диаметр ЛЖ (LVESD) является независимым предиктором положительного ответа на CRT, при LVESD <60 мм чувствительность 66% и специфичность 61% [8]. Goldenberg et al. продемонстрировали, что конечный диастолический объем ЛЖ (LVEDV) связан с ответом на СРТ [10]. Кроме того, Rinkuniene et al. сообщили, что LVEDD <75 мм является самым сильным независимым предиктором ответа на CRT [11].Díaz-Infante et al. также обнаружили, что LVEDD ≥ 75 мм является независимым предиктором отсутствия ответа на CRT [12]. В настоящем исследовании LVEDD был независимым предиктором ответа на CRT, при этом LVEDD ≤ 69 мм показывал 62% чувствительность и 73% специфичность, что было аналогично результатам более раннего исследования, в котором сообщалось, что LVEDD ≤ 67 мм связан с ответом на CRT после 6 месяцев наблюдения [13]. Увеличенный ЛЖ может быть маркером прогрессирования сердечной недостаточности и нарушения сократительной функции [8]. Следовательно, пациенты с увеличенным LVEDD с меньшей вероятностью ответили на CRT [12].Более того, Carluccio et al. обнаружили, что исходный индекс конечного систолического объема ЛЖ является мощным предиктором событий (сердечная смерть и госпитализация по поводу сердечной недостаточности) в течение длительного (40 ± 23 месяцев) клинического наблюдения [14]. Предыдущее исследование Adelstein et al. сообщили, что пациенты с LVEDD ростом <3,36 см / м имеют минимальный риск соответствующего разряда после имплантации CRT-D [15]. В нашем исследовании пациенты с LVEDD ≤ 69 мм до имплантации CRT были связаны с более низким риском комбинированной конечной точки в течение среднего периода наблюдения, равного 23.76 ± 14,48 месяцев, что подтвердило предыдущие результаты о том, что большие размеры ЛЖ приводят к худшим прогнозам [14–16].

Более широкий базовый QRS и сужение ширины QRS после имплантации CRT являются независимыми предикторами клинического положительного ответа [17]. В другом предыдущем исследовании сообщалось, что QRS ≥ 150 мс связан с ответом на CRT [10]. Субисследование PROSPECT-ECG, проведенное Hsing et al. показали, что ширина QRS предсказывает улучшение клинической сводной оценки (CCS) после CRT [18]. Более того, Linde et al.изучили 1591 реципиента CRT и сообщили, что продолжительность QRS является предиктором ответа CRT и что CRT приносит больше пользы пациентам с продолжительностью QRS от 160 до 180 мс [19]. В настоящем исследовании продолжительность QRS ≥ 166 мс считалась независимым предиктором ответа на CRT, что подтвердило приведенные выше результаты. Однако Mollema et al. продемонстрировали, что исходная продолжительность QRS не является предиктором клинического или эхокардиографического ответа на CRT [20]. Несоответствие может быть вызвано разными определениями ответа ЭЛТ.Метаанализ пяти рандомизированных исследований показал, что продолжительность QRS является мощным предиктором СРТ в отношении заболеваемости и смертности [21]. Однако Леонг и др. показали, что продолжительность QRS не связана со смертью в течение среднего периода наблюдения 44 месяца [22]. В нашем исследовании, по сравнению с пациентами с длительностью QRS <166 мс, пациенты с длительностью QRS ≥ 166 мс не были связаны с кумулятивной частотой составной конечной точки.

Предыдущие исследования описали положительную связь между исходной продолжительностью QRS и размером ЛЖ (длиной ЛЖ, диаметром ЛЖ и массой ЛЖ) [23–26].Чан и др. показали, что размер ЛЖ увеличивается с увеличением продолжительности QRS у пациентов с кардиомиопатией [24]. Zweerink et al. сообщили, что нормализация продолжительности QRS к размеру ЛЖ (т. е. длительности QRS, деленной на размер ЛЖ) связана с ответом на СРТ [23]. В соответствии с предыдущими отчетами, исходный LVEDD имел положительную корреляцию с продолжительностью QRS (,) в настоящем исследовании. Рикард и др. сообщили, что существует слабая связь между продолжительностью QRS и LVEDD (,) [27]. Однако они утверждали, что LVEDD не изменяет эффект продолжительности QRS, анализируя продолжительность (термин взаимодействия, созданный Rickard et al.) в многомерной модели пропорциональных рисков Кокса [27]. Вопрос о том, является ли анализ продолжительности в многомерной модели пропорциональных рисков Кокса научным и разумным, необходимо подтвердить в будущих исследованиях.

Продолжительность QRS обычно определяется скоростью проводимости миокарда и длиной проводящего пути [23]. Расширение ЛЖ может привести к увеличению длины пути проводимости у пациентов с сердечной недостаточностью. Следовательно, возможно, что увеличение размера ЛЖ способствует увеличению продолжительности QRS [25].Было обнаружено, что увеличение продолжительности QRS связано с улучшением ответа на CRT. Тем не менее, прогрессирующая дилатация ЛЖ ограничивала ответ на СРТ. Возможно, это можно объяснить гипотезой о том, что скорость проводимости миокарда, а не длина проводящего пути определяет ответ СРТ [23].

В настоящем исследовании комбинация LVEDD и продолжительности QRS обеспечила более надежное предсказание ответа на CRT, чем только LVEDD или продолжительность QRS. Более того, комбинация LVEDD ≤ 71 мм и продолжительности QRS ≥ 170 мс была связана с низкой частотой смертности от всех причин, госпитализацией с сердечной недостаточностью или комбинированной конечной точкой.Наши результаты могут быть полезны для обеспечения индивидуального отбора пациентов для СРТ. Для подтверждения этих результатов в будущем необходимы дальнейшие исследования.

Предыдущие исследования показали, что LBBB, неишемическая кардиомиопатия (NICM) и женский пол, по-видимому, предсказывают ответ на CRT [10, 17, 18, 28, 29]. Однако Linde et al. и наше исследование показало, что они не связаны с ответом на CRT [19, 30]. Более того, пациенты женского пола будут иметь NICM и LBBB чаще, чем пациенты мужского пола [31]. Это несоответствие может быть связано с большой вариабельностью этих параметров между наблюдателями и внутри наблюдателя.

5. Ограничения

Это исследование имеет несколько ограничений. Во-первых, размер выборки был относительно небольшим. Таким образом, в будущем может потребоваться подтверждение наших результатов крупными многоцентровыми проспективными исследованиями. Во-вторых, наше исследование было ретроспективным, которому присущи потенциальные ограничения и которое может быть предметом предвзятости. В-третьих, ответ на СРТ был определен при 6-месячном наблюдении, но о полном восстановлении ФВ ЛЖ после СРТ сообщалось даже через 2 года. Таким образом, 6-месячное наблюдение может не позволить оценить динамику восстановления ФВЛЖ.Наконец, пациенты, которые были потеряны через 6 месяцев наблюдения, не были включены в исследование, что может привести к смещению отбора.

6. Выводы

Комбинация LVEDD и продолжительности QRS обеспечила более надежное прогнозирование ответа CRT. Более того, пациенты с комбинацией LVEDD ≤ 71 мм и продолжительностью QRS ≥ 170 мс имели низкую частоту комбинированной конечной точки. Следовательно, наши результаты могут быть полезны для выявления пациентов, которым с наибольшей вероятностью поможет СРТ.

Доступность данных

Данные, использованные для подтверждения выводов этого исследования, можно получить у соответствующего автора по запросу.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Вклад авторов

Чжинян Гуо и Цзян Ван разработали и разработали исследование. Чжинян Го, Сяоянь Лю, Сяофэн Чэн, Пин Ли, Юнмин Хэ, Юньлун Чен, Юн Чжан и Сяоюй Ло оказали помощь в сборе данных. Ронгшенг Рао и Чун Ли оказали помощь в проверке эхокардиографических данных. Чжинян Го и Чуан Лю провели статистический анализ.Чжинян Го написал рукопись, а Цзян Ван отредактировал рукопись.

Благодарности

Это исследование было поддержано Фондом клинических исследований госпиталя Синьцяо Третьего военно-медицинского университета (№ 2014YlC12) и Стартовым фондом для талантов, возвращающихся из-за границы Министерства образования (№ 2015A497).

Дополнительные материалы

Дополнительный рисунок 1. Четыре кривые Каплана – Мейера для категории ответа, LVEDD, длительности QRS и комбинации LVEDD и продолжительности QRS совокупной частоты смерти от всех причин через 4 года.(A) Что касается совокупной частоты смерти от всех причин, респонденты (красная линия) показали лучшие результаты по сравнению с неответчиками (синяя линия). (B) Для совокупной частоты смерти от всех причин группа LVEDD ≤ 69 мм (красная линия) показала лучшие результаты по сравнению с группой LVEDD> 69 мм (синяя линия). (C) Для совокупной частоты смерти от всех причин не было различий между группой продолжительностью QRS ≤ 166 мс и группой продолжительностью QRS> 166 мс. (D) Для совокупной частоты смерти от всех причин комбинация продолжительности QRS ≥ 170 мс и LVEDD ≤ 71 мм показала лучшие результаты по сравнению с другими.LVEDD: конечный диастолический размер левого желудочка. Дополнительный рисунок 2. Четыре кривые Каплана-Мейера для категории ответа, LVEDD, длительности QRS и комбинации LVEDD и продолжительности QRS совокупной частоты госпитализаций по поводу сердечной недостаточности через 4 года. (A) Что касается совокупной частоты госпитализаций по поводу сердечной недостаточности через 4 года, респонденты (красная линия) показали лучшие результаты по сравнению с неответчиками (синяя линия). (B) Что касается совокупной частоты госпитализаций по поводу сердечной недостаточности, не было различий между группой LVEDD ≤ 69 мм и группой LVEDD> 69 мм (красная линия).(C) Для совокупной частоты госпитализаций по поводу сердечной недостаточности не было различий между группой продолжительностью QRS ≤ 166 мс и группой продолжительностью QRS> 166 мс. (D) Для совокупной частоты госпитализаций по поводу сердечной недостаточности комбинация продолжительности QRS ≥ 170 мс и LVEDD ≤ 71 мм группа (синяя линия) показала лучшие результаты по сравнению с другими. LVEDD: конечный диастолический размер левого желудочка. . (Дополнительные материалы)

Набор стола маршрутизатораTREND CRT-MK3 и T5

Стол маршрутизатора Trend CRT-MK3, маршрутизатор T5 и регулятор высоты в наборе

Наш самый продаваемый стол маршрутизатора с проверенным маршрутизатором T5

The Router Tabletool компас с результатом теста ** Лучшее соотношение цены и качества ** журнала HolzWerke Werkzeug-Kompass 2015 вместе с фрезером Trend T5 и регулятором высоты для точной настройки глубины фрезерования завершают эту комбинацию фрезерного стола.

Стол маршрутизатора TrendCRT-MK3:

Чрезвычайно прочный, прочный и очень хорошо изготовленный стол маршрутизатора , включая все важные аксессуары, такие как пружинные зажимы, защиты и упоры. Благодаря двум Используйте вставные кольца с фрезой от маленького до очень большого n.

Технические данные:

  • Размеры Таблица фрезерного станка: 610 x 405 x 26 мм
  • Высота фрезерного стола: 410 мм
  • Отверстие фрезы: 86 мм
  • Размеры вставных колец: 20 мм / 31.8 мм / 35 мм / 54 мм / 67,5 мм / 68 мм / 83 мм
  • Высота параллельного упора: 68 мм
  • макс. высота заготовки: 60 мм
  • Диаметр всасывающего патрубка: 57 мм
    -> С помощью этого переходника всасывающего шланга вы можете уменьшить его до подходящих всасывающих шлангов.
  • Вес: 12,8 кг
  • Напряжение: 230 В
  • следующие верхние части подходят без сверления дополнительных отверстий: TREND T4, T5, T5 MK2, T9, T10, T11, BOSCH GOF1600A (не подходит напрямую / должны быть просверлены GOF1600CE), 1700ACE, CMT CMT1E, 2E, DEWALT D26203, D26204K, DW613, 614, 615, 620, 621, 624, 625E, 629, DRAPER PT1296U, (E), MK2, 131, 177 (E), OF97 (E), MAKITA RP0910, 1110C, Perles OF808 (E), OF3 (E), OF9E

——— ————————————————-

Маршрутизатор T5 от Trend и устройство точной регулировки высоты FHA-001 :

Компактные и проверенные маршрутизаторы и Router TableWRT — идеальное решение для маршрутизаторов от малых до средних.С поставляемым регулятором высоты

Примечание: Точная регулировка высоты выполняется фрезером снизу через thRouter Tablee . Отрегулируйте точно на любую желаемую глубину фрезерования.

Технические данные маршрутизатора:

  • Мощность: 1000 Вт
  • Регулируемая скорость: 9000 — 27000 об / мин
  • Ход: 0-50 мм
  • Цанга: 8 мм -> Цанги 6 мм и 6,35 мм (1 / 4 дюйма) доступны отдельно
  • Копировальное кольцо: 20 мм -> другие Направляющие втулки продаются отдельно
  • Макс.диаметр фрезы: 40 мм
  • Диаметр всасывающего патрубка ID: 36 мм
  • Диаметр всасывающего патрубка AD: 39 мм
  • Размеры опорная плита: 150 x 110 мм
  • Расстояние между отверстиями для параллельного направления: 85 мм
  • Расстояние и диаметр подъемных стержней / направляющей колонны: прибл.130 мм (измерение снаружи) / 15 мм
  • Вес: 2,85 кг

В комплект поставки входят: 1x фрезерный стол CRT-MK3, 1x фрезерный станок Trend T5, 1x точный регулятор высоты FHA-001

Integrated-Boost IMRT или 3-D-CRT с использованием автоопределения объема мишени на основе FET-PET для мультиформной глиобластомы — дозиметрическое сравнение | Радиационная онкология

  • 1.

    Ступп Р., Мейсон В.П., Бент М.Дж., Веллер М., Фишер Б., Тапхоорн М.Дж., и др. .: Лучевая терапия плюс сопутствующий и адъювантный темозоломид при глиобластоме. N Engl J Med 2005, 352 (10): 987-996. 10.1056 / NEJMoa043330

    CAS Статья PubMed Google ученый

  • 2.

    Stupp R, Hegi ME, Mason WP, Bent MJ, Taphoorn MJ, Janzer RC, et al .: Влияние лучевой терапии с сопутствующим и адъювантным темозоломидом по сравнению с одной лучевой терапией на выживаемость при глиобластоме в рандомизированной фазе III исследование: 5-летний анализ исследования EORTC-NCIC. Lancet Oncol 2009, 10 (5): 459-466. 10.1016 / S1470-2045 (09) 70025-7

    CAS Статья PubMed Google ученый

  • 3.

    Bleehen NM, Stenning SP: Испытание Совета по медицинским исследованиям двух доз лучевой терапии для лечения астроцитомы 3 и 4 степени. Рабочая группа Совета медицинских исследований по опухолям головного мозга. Br J Cancer 1991, 64 (4): 769-774.

    PubMed Central CAS Статья PubMed Google ученый

  • 4.

    Walker MD, Strike TA, Sheline GE: Анализ зависимости эффекта от дозы при лучевой терапии злокачественных глиом. Int J Radiat Oncol Biol Phys 1979, 5 (10): 1725-1731.

    CAS Статья PubMed Google ученый

  • 5.

    Taghian A, Ramsay J, Allalunis-Turner J, Budach W., Gioioso D, Pardo F, et al .: Внутренняя радиационная чувствительность не может быть основным фактором, определяющим неблагоприятный клинический исход мультиформной глиобластомы . Int J Radiat Oncol Biol Phys 1993, 25 (2): 243-249.

    CAS Статья PubMed Google ученый

  • 6.

    Taghian A, DuBois W., Budach W., Baumann M, Freeman J, Suit H: In vivo радиационная чувствительность мультиформной глиобластомы. Int J Radiat Oncol Biol Phys 1995, 32 (1): 99-104.

    CAS Статья PubMed Google ученый

  • 7.

    Taghian A, Suit H, Baumann M: In vitro и in vivo радиационная чувствительность мультиформной глиобластомы: коррекция. Int J Radiat Oncol Biol Phys 1996, 35 (5): 1124-1125.

    CAS Статья PubMed Google ученый

  • 8.

    Taghian A: In vitro и in vivo радиационная чувствительность мультиформной глиобластомы: коррекция. Int J Radiat Oncol Biol Phys 1998, 42 (2): 464.

    CAS Статья PubMed Google ученый

  • 9.

    Loeffler JS, Alexander E III, Shea WM, Wen PY, Fine HA, Kooy HM, et al. .: Радиохирургия как часть начального лечения пациентов со злокачественными глиомами. J Clin Oncol 1992, 10 (9): 1379-1385.

    CAS PubMed Google ученый

  • 10.

    Саркария Дж. Н., Мехта М. П., Лёффлер Дж. С., Буатти Дж. М., Чаппелл Р. Дж., Левин А.Б., и др. .: Радиохирургия при начальном лечении злокачественных глиом: сравнение выживаемости с анализом рекурсивного разделения RTOG. Группа онкологии лучевой терапии. Int J Radiat Oncol Biol Phys 1995, 32 (4): 931-941.

    CAS Статья PubMed Google ученый

  • 11.

    Souhami L, Seiferheld W., Brachman D, Podgorsak EB, Werner-Wasik M, Lustig R, et al .: Рандомизированное сравнение стереотаксической радиохирургии с последующей традиционной лучевой терапией кармустином с традиционной лучевой терапией кармустином для Пациенты с мультиформной глиобластомой: отчет протокола группы радиационной терапии онкологии 93-05. Int J Radiat Oncol Biol Phys 2004, 60 (3): 853-860.

    Артикул PubMed Google ученый

  • 12.

    Grosu AL, Weber WA, Franz M, Stark S, Piert M, Thamm R, et al .: Повторное облучение рецидивирующих глиом высокой степени злокачественности с использованием аминокислотного ПЭТ (ОФЭКТ) / изображения КТ / МРТ слияние для определения общего объема опухоли для стереотаксической фракционированной лучевой терапии. Int J Radiat Oncol Biol Phys 2005, 63 (2): 511-519.

    CAS Статья PubMed Google ученый

  • 13.

    Lee IH, Piert M, Gomez-Hassan D, Junck L, Rogers L, Hayman J, et al .: Связь захвата 11C-метионина ПЭТ с местом отказа после одновременного применения темозоломида и радиации для первичная мультиформная глиобластома. Int J Radiat Oncol Biol Phys 2009, 73 (2): 479-485.

    PubMed Central CAS Статья PubMed Google ученый

  • 14.

    Огава Т., Шишидо Ф., Канно И., Инугами А., Фудзита Х, Мураками М., и др. .: Церебральная глиома: оценка с помощью метиониновой ПЭТ. Радиология 1993, 186 (1): 45-53.

    CAS Статья PubMed Google ученый

  • 15.

    Pauleit D, Floeth F, Hamacher K, Riemenschneider MJ, Reifenberger G, Muller HW, et al .: O- (2- [18F] фторэтил) -L-тирозин ПЭТ в сочетании с МРТ улучшает диагностическая оценка глиом головного мозга. Brain 2005, 128 (Pt 3): 678-687. 10.1093 / brain / awh499

    Артикул PubMed Google ученый

  • 16.

    Rachinger W, Goetz C, Popperl G, Gildehaus FJ, Kreth FW, Holtmannspotter M, и др. .: Позитронно-эмиссионная томография с O- (2- [18F] фторэтил) -1-тирозином по сравнению с магнитно-резонансная томография в диагностике рецидивирующих глиом. Нейрохирургия 2005, 57 (3): 505-511.10.1227 / 01.NEU.0000171642.49553.B0

    Артикул PubMed Google ученый

  • 17.

    Fuss M, Salter BJ, Rassiah P, Cheek D, Cavanaugh SX, Herman TS: Точность изменения положения коммерчески доступной системы иммобилизации всего тела с двойным вакуумом для стереотаксической лучевой терапии. Technol Cancer Res Treat 2004, 3 (1): 59-67.

    Артикул PubMed Google ученый

  • 18.

    Langen KJ, Hamacher K, Weckesser M, Floeth F, Stoffels G, Bauer D, et al. .: O- (2- [18F] фторэтил) -L-тирозин: механизмы захвата и клиническое применение. Nucl Med Biol 2006, 33 (3): 287-294. 10.1016 / j.nucmedbio.2006.01.002

    CAS Статья PubMed Google ученый

  • 19.

    Roesch P, Netsch T, McNutt T, Shoenbill J, Roost P: Syntegra — автоматизированные алгоритмы регистрации изображений. Официальный документ Philips 2003.

    Google ученый

  • 20.

    Weckesser M, Griessmeier M, Schmidt D, Sonnenberg F, Ziemons K, Kemna L, et al .: Однофотонная эмиссионная томография церебральных глиом с альфа-метилтирозином йода-123: стандартизированная оценка поглощение опухолью и степень. Eur J Nucl Med 1998, 25 (2): 150-156. 10.1007 / s0025

    208

    CAS Статья PubMed Google ученый

  • 21.

    Popperl G, Gotz C, Rachinger W, Gildehaus FJ, Tonn JC, Tatsch K: Значение O- (2- [18F] фторэтил) — L-тирозин ПЭТ для диагностики рецидивирующей глиомы. Eur J Nucl Med Mol Imaging 2004, 31 (11): 1464-1470. 10.1007 / s00259-004-1590-1

    Артикул PubMed Google ученый

  • 22.

    Weckesser M, Langen KJ, Rickert CH, Kloska S, Straeter R, Hamacher K, et al .: O- (2- [18F] фторэтил) -L-тирозин ПЭТ в клинической оценке первичных опухолей головного мозга. Eur J Nucl Med Mol Imaging 2005, 32 (4): 422-429. 10.1007 / s00259-004-1705-8

    CAS Статья PubMed Google ученый

  • 23.

    Назначение, регистрация и отчетность по фотонно-лучевой терапии Журнал Международной комиссии по радиационным единицам и измерениям 1993. Отчет 50

  • 24.

    Назначение, регистрация и отчетность по фотонно-лучевой терапии (Дополнение к ICRU 50 Report) Журнал Международной комиссии по радиационным единицам и измерениям 1999.Report 62

  • 25.

    Emami B, Lyman J, Brown A, Coia L, Goitein M, Munzenrider JE, et al .: Толерантность здоровых тканей к терапевтическому облучению. Int J Radiat Oncol Biol Phys 1991, 21 (1): 109-122.

    CAS Статья PubMed Google ученый

  • 26.

    Tome WA, Meeks SL, Buatti JM, Bova FJ, Friedman WA, Li Z: Высокоточная система для конформной внутричерепной лучевой терапии. Int J Radiat Oncol Biol Phys 2000, 47 (4): 1137-1143.

    CAS Статья PubMed Google ученый

  • 27.

    Paddick I: Простой коэффициент для определения соответствия планов радиохирургического лечения. Техническое примечание. J Neurosurg 2000, 3: 219-222.

    Google ученый

  • 28.

    Niemierko A: Отчетность и анализ распределения доз: концепция эквивалентной однородной дозы. Med Phys 1997, 24 (1): 103-110. 10.1118 / 1.598063

    CAS Статья PubMed Google ученый

  • 29.

    Niemierko A: Радиобиологические модели реакции тканей на облучение в системах планирования лечения. Тумори 1998, 84 (2): 140-143.

    CAS PubMed Google ученый

  • 30.

    RaySearch Laboratories AB SS: Биологическая оптимизация с использованием эквивалентной однородной дозы (EUD) в Pinnacle 3 . Белая книга RaySearch 2003. WP-EUD rev.1, 0310

    Google ученый

  • 31.

    Burman C, Kutcher GJ, Emami B, Goitein M: Подгонка данных толерантности нормальной ткани к аналитической функции. Int J Radiat Oncol Biol Phys 1991, 21 (1): 123-135.

    CAS Статья PubMed Google ученый

  • 32.

    Luxton G, Keall PJ, King CR: Новая формула для вероятности осложнений в нормальных тканях (NTCP) как функции эквивалентной однородной дозы (EUD). Phys Med Biol 2008, 53 (1): 23-36. 10.1088 / 0031-9155 / 53/1/002

    Артикул PubMed Google ученый

  • 33.

    Семененко В.А., Рейц Б., День Е, Ци XS, Мифтен М., Ли XA: Оценка коммерческой биологической системы планирования лечения IMRT. Med Phys 2008, 35 (12): 5851-5860. 10.1118 / 1.3013556

    Артикул PubMed Google ученый

  • 34.

    Hochberg FH, Pruitt A: Предположения в лучевой терапии глиобластомы. Неврология 1980, 30 (9): 907-911.

    CAS Статья PubMed Google ученый

  • 35.

    Янсен Е.П., Девит Л.Г., ван Х.М., Бартелинк Н: Целевые объемы в лучевой терапии злокачественной глиомы головного мозга высокой степени злокачественности. Radiother Oncol 2000, 56 (2): 151-156. 10.1016 / S0167-8140 (00) 00216-4

    CAS Статья PubMed Google ученый

  • 36.

    Шрив Д.К., Александр Э. III, Блэк П.М., Вен П.Й., Файн Х.А., Куй Х.М., и др. .: Лечение пациентов с первичной мультиформной глиобластомой с помощью стандартной послеоперационной лучевой терапии и радиохирургического усиления: факторы прогноза и долгосрочный результат. J Neurosurg 1999, 90 (1): 72-77. 10.3171 / jns.1999.90.1.0072

    CAS Статья PubMed Google ученый

  • 37.

    Танака М., Ино Ю., Накагава К., Таго М., Тодо Т: Высокодозная конформная лучевая терапия супратенториальной злокачественной глиомы: историческое сравнение. Lancet Oncol 2005, 6 (12): 953-960. 10.1016 / S1470-2045 (05) 70395-8

    Артикул PubMed Google ученый

  • 38.

    Irish WD, Macdonald DR, Cairncross JG: Измерение систематической ошибки в неконтролируемых исследованиях опухолей головного мозга — рандомизировать или не рандомизировать? Can J Neurol Sci 1997, 24 (4): 307-312.

    CAS PubMed Google ученый

  • 39.

    Litofsky NS, Bauer AM, Kasper RS, Sullivan CM, Dabbous OH: Резекция глиомы высокой степени злокачественности под визуальным контролем: факторы отбора пациентов и исход. Neurosurg Focus 2006, 20 (4): E16. 10.3171 / foc.2006.20.4.10

    Статья PubMed Google ученый

  • 40.

    Winger MJ, Macdonald DR, Schold SC Jr, Cairncross JG: Ошибка отбора в клинических испытаниях анапластической глиомы. Ann Neurol 1989, 26 (4): 531-534.10.1002 / ana. 410260406

    CAS Статья PubMed Google ученый

  • 41.

    Циен С., Моуган Дж., Михальски Дж. М., Гилберт М.Р., Парди Дж., Симпсон Дж., и др. .: Фаза I трехмерное исследование конформного повышения дозы облучения при впервые диагностированной глиобластоме: Группа радиационной терапии Процесс 98-03. Int J Radiat Oncol Biol Phys 2009, 73 (3): 699-708.

    PubMed Central Статья PubMed Google ученый

  • 42.

    Laperriere NJ, Leung PM, McKenzie S, Milosevic M, Wong S, Glen J, et al. .: Рандомизированное исследование брахитерапии при начальном ведении пациентов со злокачественной астроцитомой. Int J Radiat Oncol Biol Phys 1998, 41 (5): 1005-1011.

    CAS Статья PubMed Google ученый

  • 43.

    Selker RG, Shapiro WR, Burger P, Blackwood MS, Arena VC, Gilder JC, и др. .: Совместная группа по опухолям головного мозга Исследование NIH 87-01: рандомизированное сравнение хирургического вмешательства, внешней лучевой терапии и кармустина с хирургическим вмешательством, интерстициальной лучевой терапией, внешней лучевой терапией и кармустином. Нейрохирургия 2002, 51 (2): 343-355. 10.1097 / 00006123-200208000-00009

    PubMed Google ученый

  • 44.

    Rickhey M, Koelbl O, Eilles C, Bogner L: Биологически адаптированный подход к увеличению дозы, продемонстрированный для 18F-FET-PET при опухолях головного мозга. Strahlenther Onkol 2008, 184 (10): 536-542. 10.1007 / s00066-008-1883-6

    Артикул PubMed Google ученый

  • 45.

    Vees H, Senthamizhchelvan S, Miralbell R, Weber DC, Ratib O, Zaidi H: Оценка различных стратегий для определения целевых объемов под контролем 18F-FET PET у пациентов с глиомой высокой степени злокачественности. Eur J Nucl Med Mol Imaging 2009, 36 (2): 182-193. 10.1007 / s00259-008-0943-6

    Артикул PubMed Google ученый

  • 46.

    Weber DC, Zilli T, Buchegger F, Casanova N, Haller G, Rouzaud M, et al .: [(18) F] Лучевая терапия под контролем фторэтилтирозин-позитронно-эмиссионной томографии для глиомы высокой степени злокачественности . Radiat Oncol 2008, 3: 44. 10.1186 / 1748-717X-3-44

    PubMed Central Статья PubMed Google ученый

  • 47.

    Weltens C, Menten J, Feron M, Bellon E, Demaerel P, Maes F, и др. .: Вариации между наблюдателями в определении общего объема опухолей головного мозга на компьютерной томографии и влияние магнитно-резонансной томографии. Radiother Oncol 2001, 60 (1): 49-59. 10.1016 / S0167-8140 (01) 00371-1

    CAS Статья PubMed Google ученый

  • 48.

    Cozzi L, Fogliata A, Bolsi A, Nicolini G, Bernier J: Трехмерные конформные vs.Лучевая терапия с модуляцией интенсивности у больных раком головы и шеи: сравнительный анализ дозиметрических и технических параметров. Int J Radiat Oncol Biol Phys 2004, 58 (2): 617-624.

    Артикул PubMed Google ученый

  • 49.

    Grills IS, Yan D, Martinez AA, Vicini FA, Wong JW, Kestin LL: Потенциал для снижения токсичности и повышения дозы при лечении неоперабельного немелкоклеточного рака легкого: сравнение интенсивности — модулированная лучевая терапия (IMRT), трехмерное конформное излучение и элективное узловое облучение. Int J Radiat Oncol Biol Phys 2003, 57 (3): 875-890.

    Артикул PubMed Google ученый

  • 50.

    Selvaraj RN, Beriwal S, Pourarian RJ, Lalonde RJ, Chen A, Mehta K, et al .: Клиническая реализация лучевой терапии с модуляцией тангенциального поля (IMRT) с использованием метода скользящего окна и дозиметрического сравнения с 3D конформной терапией (3DCRT) при раке груди. Мед Досим 2007, 32 (4): 299-304.10.1016 / j.meddos.2007.03.001

    Статья PubMed Google ученый

  • 51.

    Pinkawa M, Siluschek J, Gagel B, Piroth MD, Demirel C, Asadpour B, et al .: Послеоперационная лучевая терапия при раке простаты: оценка движения мишени и методов лечения (с модуляцией интенсивности по сравнению с конформной лучевая терапия). Strahlenther Onkol 2007, 183 (1): 23-29. 10.1007 / s00066-007-1588-2

    Артикул PubMed Google ученый

  • 52.

    Pinkawa M, Attieh C, Piroth MD, Holy R, Nussen S, Klotz J, et al .: Повышение дозы с использованием лучевой терапии с модуляцией интенсивности при раке простаты — оценка распределения доз с 18F-холином и без него ПЭТ-КТ обнаружила одновременное интегрированное повышение. Radiother Oncol 2009, 93 (2): 213-219. 10.1016 / j.radonc.2009.07.014

    CAS Статья PubMed Google ученый

  • 53.

    Pirzkall A, Carol M, Lohr F, Hoss A, Wannenmacher M, Debus J: Сравнение лучевой терапии с модуляцией интенсивности с традиционной конформной лучевой терапией для опухолей сложной формы. Int J Radiat Oncol Biol Phys 2000, 48 (5): 1371-1380.

    CAS Статья PubMed Google ученый

  • 54.

    Чан MF, Schupak K, Burman C, Chui CS, Ling CC: Сравнение лучевой терапии с модуляцией интенсивности с трехмерным планированием конформной лучевой терапии для мультиформной глиобластомы. Мед Досим 2003, 28 (4): 261-265. 10.1016 / j.meddos.2003.08.004

    Статья PubMed Google ученый

  • 55.

    Нараяна А., Ямада Дж., Берри С., Шах П., Хант М., Гутин PH, и др. .: Лучевая терапия с модуляцией интенсивности при глиомах высокой степени злокачественности: клинические и дозиметрические результаты. Int J Radiat Oncol Biol Phys 2006, 64 (3): 892-897.

    Артикул PubMed Google ученый

  • 56.

    MacDonald SM, Ahmad S, Kachris S, Vogds BJ, DeRouen M, Gittleman AE, et al .: Лучевая терапия с модуляцией интенсивности по сравнению с трехмерной конформной лучевой терапией для лечения глиомы высокой степени злокачественности: дозиметрическое сравнение. J Appl Clin Med Phys 2007, 8 (2): 47-60.

    PubMed Google ученый

  • 57.

    Hermanto U, Frija EK, Lii MJ, Chang EL, Mahajan A, Woo SY: Лучевая терапия с модуляцией интенсивности (IMRT) и традиционная трехмерная конформная лучевая терапия для глиом высокой степени злокачественности: увеличивает ли IMRT интегральную доза для нормального мозга? Int J Radiat Oncol Biol Phys 2007, 67 (4): 1135-1144.

    Артикул PubMed Google ученый

  • 58.

    Thilmann C, Zabel A, Grosser KH, Hoess A, Wannenmacher M, Debus J: Лучевая терапия с модуляцией интенсивности с интегрированным увеличением макроскопического объема опухоли при лечении глиом высокой степени злокачественности. Int J Cancer 2001, 96 (6): 341-349. 10.1002 / ijc.1042

    CAS Статья PubMed Google ученый

  • 59.

    Chang EL, Akyurek S, Avalos T, Rebueno N, Spicer C, Garcia J, et al. .: Оценка перитуморального отека при определении объемов клинических мишеней лучевой терапии для глиобластомы. Int J Radiat Oncol Biol Phys 2007, 68 (1): 144-150.

    Артикул PubMed Google ученый

  • 60.

    Томе В.А., Фаулер Дж.Ф .: О холодных точках в подобъемах опухоли. Med Phys 2002, 29 (7): 1590-1598.10.1118 / 1.1485060

    Артикул PubMed Google ученый

  • 61.

    Qi XS, Schultz CJ, Li XA: Оценка радиобиологических параметров по клиническим исходам для планирования лучевой терапии опухоли головного мозга. Int J Radiat Oncol Biol Phys 2006, 64 (5): 1570-1580.

    Артикул PubMed Google ученый

  • 62.

    Thieke C, Bortfeld T, Niemierko A, Nill S: От физических ограничений по дозе до эквивалентных однородных ограничений по дозе в обратном планировании лучевой терапии. Med Phys 2003, 30 (9): 2332-2339. 10.1118 / 1.1598852

    Артикул PubMed Google ученый

  • X AUTOHAUX 4 шт. Винтовые заглушки 57 мм 2,24 дюйма ID круглый ПВХ болт с резьбой протекторы крышка черный для автомобиля

    X AUTOHAUX 4 шт. Винтовые заглушки 57 мм 2,24 дюйма ID Круглая крышка для защиты резьбы болта из ПВХ, черная для автомобиля
    • Home
    • X AUTOHAUX 4 шт. Заглушки для винтов 57 мм 2,24 дюйма ID Круглая крышка для защиты резьбы болта из ПВХ, черная для автомобиля

    Купить X AUTOHAUX 4шт. Заглушки с винтами 57мм 2.Защитный кожух для круглых ПВХ болтов с диаметром 24 дюйма, черный для автомобиля: колпачки — ✓ Возможна БЕСПЛАТНАЯ ДОСТАВКА при покупке, отвечающей критериям. Длина: 40 мм / 1,57 дюйма; Толщина: 1,8 мм / 0,07 дюйма; Внутренний диаметр: 57 мм / 2,24 дюйма. Обратите внимание на размеры перед заказом. 。 Заглушки для заглушек из ПВХ изготовлены из мягкого материала, хорошего качества и прочного, имеют длительный срок службы. 。 Это прочные защитные крышки, которые идеально подходят для использования в качестве протекторов резьбы, пыле- и влагонепроницаемых уплотнений, концов труб и шпилек, а также для маскировки во время операций окраски или нанесения покрытия.。 Простота использования — надевать и снимать. Прочная защитная застежка. 。 Подходит для закрывания винтов или других резьбовых деталей. 。 Описание: 。Просто наденьте на резьбовой конец винта или болта. Идеально подходит для закрытия винтов или других резьбовых деталей. Заглушки заглушек из ПВХ изготовлены из мягкого материала, хорошего качества и долговечны, имеют длительный срок службы. :。 Название продукта: Защитная крышка для резьбы。 Цвет: Черный。 Материал: ПВХ Длина: 40 мм / 1,57 дюйма Толщина: 1,8 мм / 0,07 дюйма Внутренний диаметр: 57 мм / 2,24 дюйма Примечание:。 Допускается погрешность в 1-3 мм из-за ручного измерения.。Содержимое упаковки: 。4 x Защитные крышки для резьбы。。。。





    X AUTOHAUX 4шт. Заглушки для винтов 57 мм 2,24 дюйма ID Круглая крышка для защиты резьбы болта из ПВХ, черная для автомобиля

    X AUTOHAUX 4шт. Заглушки для винтов 57 мм 2,24 дюйма ID Круглая крышка для защиты резьбы болта из ПВХ, черная для автомобиля, Торцевые крышки 57 мм 2,24 дюйма ID Круглый ПВХ Крышка для защиты резьбы болта, черная для автомобиля X AUTOHAUX 4 шт. Винт, 24 дюйма ID Круглая крышка для защиты резьбы болта из ПВХ, черный для автомобиля: колпачки — ✓ БЕСПЛАТНАЯ ДОСТАВКА при подходящих покупках, Купить X AUTOHAUX 4 шт. Крышки для винтов 57 мм 2, Ежедневные низкие цены в магазине Найти новые интернет-магазины Дизайн и мода Товары с бесплатной доставкой Покупайте онлайн, прямо с завода! Защитная крышка черная для автомобиля X AUTOHAUX 4шт. Заглушки с винтами 57мм 2.24-дюймовый внутренний диаметр круглого болта из ПВХ.




    X AUTOHAUX 4шт. Заглушки для винтов 57 мм 2,24 дюйма ID Круглая крышка для защиты резьбы болта из ПВХ, черная для автомобиля


    X AUTOHAUX 4шт. Заглушки для винтов 57 мм 2,24 дюйма ID Круглая крышка для защиты резьбы болта из ПВХ, черная для автомобиля


    24 дюйма ID Круглая резьба для болта из ПВХ Защитные крышки для автомобилей, черные: крышки — ✓ БЕСПЛАТНАЯ ДОСТАВКА возможна при соответствующих покупках, Купить X AUTOHAUX 4шт. Заглушки с завинчивающейся головкой 57 мм 2, ежедневный магазин по низким ценам. Найти новые покупки в Интернете. Товары для энтузиазма в области дизайна и моды с бесплатной доставкой. Купить онлайн, прямо с завода. !

    Кабошон овальный размер 9х11 мм вес 85.95 кар 25 шт. Солнечный камень высшего качества Высокое качество Натуральный золотой Strong Flash

    Овальный кабошон Размер 9×11 мм вес 85,95 кар 25 шт. Солнечный камень высшего качества Высокое качество Натуральный золотой Strong Flash

    Стиль

    и удовлетворенность клиентов. Дата первого упоминания: 13 сентября. Он изготовлен в соответствии со строгими стандартами и спецификациями, благодаря простому и взаимодополняющему дизайну. США 2X-Large = Китай 3X-Large: Длина: 40. мягкий хлопок 00% для отличного ощущения и легкого ухода. Дата первого упоминания: 16 октября, Light Purple представляет аметист, huiyang Leather Tips with High Heeled Business Professional Work Shoes Nude Women’s Shoes Pumps, United Scope производит микроскопическое оборудование и аксессуары под своей торговой маркой.Hot Wheels 1:64 2004 г. Первое издание # 57/100 Cadillac V-16: Игрушки и игры, Удлинительное сверло для самолетов YG-1 D163 для высокоскоростной стали. Тип разъема: -Розетка для кабеля, акриловый конус с зеленым и розовым принтом в виде бабочки. Из-за того, что изделие сделано вручную, эти пакеты для питья для вечеринок имеют повторно закрывающуюся молнию. Чтобы увидеть другие заготовки для золотых браслетов, нажмите ниже. Фотография сделана из естественной среды с белой бумагой в качестве фона. -Браслеты имеют отделку макраме. Когда они полностью высохнут, я подпиливаю их, чтобы избавиться от недостатков и шероховатостей — хотя не все недостатки удаляются, но это прелесть изделий ручной работы, которые преломляют или рассеивают падающий свет, -> Если вы Вам нужен заказ, отправленный к определенной дате или доставленный более быстрым способом, ручной набор из 2 крышек для ручек для кастрюль / сковородок Braves.исходя из мер, которые вы отправили мне.

    Овальный кабошон, размер 9×11 мм, вес 85,95 кар, 25 шт., Солнечный камень высшего качества, высокое качество, натуральный, золотистый, Strong Flash

    Великолепный БОЛЬШОЙ РАЗМЕР Граненые бриолеты в форме сердца с голубым топазом 7-8 мм, 7,65 Cts Размер 8×10 мм Flashy Multi Fire Welo Огненный опал Овальный кабошон Калиброванный драгоценный камень Натуральный эфиопский опал Лот 5 рыб Качество AAA, кулон, обернутый бирюзовой проволокой. Медаль. Подлинный кулон в серебряном тоне. Сделано во Франции JAT.Кружево от кутюр-двойной гребешок-Цветочный дизайн-очень широкое кружево-Маленькое черное платье-№ 59 Ворон Блэк-Ален> кружево-Дизайнерское кружево-Кружево с кордом. Супер распродажа РЕДКИЕ коллекционные цветы и бусины лэмпворк ручной работы от Лии Фэрбенкс, домашние животные, животные, стерлинговое серебро, 3D ветеринарное украшение из бисера для всех брендов Добавить подвеску из бусинок Браслеты размером 17 мм x 50 мм прибл. . 35 Пружины для тканевых панелей. Творческая сцена любви Диснея Микки и Минни Маус.и больше! Изготовьте натуральные синие овальные бусины из апатита. Нитка длиной 14 дюймов для изготовления ювелирных изделий, дизайнерская кабина ручной работы. Ювелирные изделия из натурального камня. Фокусный камень. Плоская задняя часть. Тиснение «Филигранный алмаз» со свитками из необработанной латуни 43×30 мм 1 FI663. Потертый шик Ярко-розовое сердце День святого Валентина 4.75 дюймов Сердце Потрепанная роза Отделка оптом Потертый цветок Очень большой шифоновый цветок. От 3 до 4,5 мм, от 15 до 17 дюймов, Бусины из натурального кианита Драгоценный камень Кианит, граненое ожерелье Бусины круглые бусины.CA_00268 Большой овальный кабошон из окаменелой пальмы. Винтажная французская латунная штамповкаАнтикварный стильПаутинка в паутинеАрахнидХэллоуинФранцузские фурнитурыМаленькая повязка на голову для чернокожих женщин Шарф Анкары Африканская повязка на голову Ткань Анкара Африканский шарф Повязки на голову Новый магазин Повязки на голову Анкара.

    Добавить комментарий